CRISPR

CRISPR2-abca4b

ID
ZDB-CRISPR-250502-12
Name
CRISPR2-abca4b
Previous Names
None
Target
Sequence
5' - GAATCCCTTGGATCCAAGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added. The PAM site was 'AGG' at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4361 abca4b
Expression
Gene expression in Wild Types + CRISPR2-abca4b
No data available
Phenotype
Phenotype resulting from CRISPR2-abca4b
No data available
Phenotype of all Fish created by or utilizing CRISPR2-abca4b
Phenotype Fish Conditions Figures
long single cone cell cone photoreceptor outer segment tubular, abnormal abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor outer segment erose, abnormal abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
long double cone cell cone photoreceptor outer segment elongated, abnormal abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment tubular, abnormal abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
long single cone cell cone photoreceptor outer segment blunt, abnormal abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment elongated, abnormal abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor outer segment dysplastic, abnormal abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short double cone cell phagocytic vesicle decreased amount, abnormal abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
long double cone cell cone photoreceptor outer segment morphology, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 6. with image from Willoughby et al., 2024
long double cone cell cone photoreceptor outer segment elongated, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with imageFig. 6. with image from Willoughby et al., 2024
short single cone cell phagocytic vesicle increased amount, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 6. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment morphology, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 7. with image from Willoughby et al., 2024
long single cone cell cone photoreceptor outer segment decreased width, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 7. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor outer segment erose, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
long single cone cell phagocytic vesicle decreased amount, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 6. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment organization quality, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 7. with image from Willoughby et al., 2024
long double cone cell phagocytic vesicle decreased amount, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 6. with image from Willoughby et al., 2024
short single cone cell phagocytic vesicle mislocalised, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 6. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment serrated, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 7. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment elongated, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with imageFig. 6. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor outer segment dysplastic, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with imageFig. 6. with image from Willoughby et al., 2024
long single cone cell cone photoreceptor outer segment blunt, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with imageFig. 6. with image from Willoughby et al., 2024
short double cone cell phagocytic vesicle decreased amount, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with imageFig. 6. with image from Willoughby et al., 2024
long single cone cell cone photoreceptor outer segment increased length, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 6. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor disc membrane misaligned with short double cone cell cone photoreceptor disc membrane, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 7. with image from Willoughby et al., 2024
long single cone cell cone photoreceptor outer segment tubular, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with imageFig. 6. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor disc membrane organization quality, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 7. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment tubular, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with imageFig. 6. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor outer segment morphology, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 6. with imageFig. 7. with image from Willoughby et al., 2024
retinal cone cell phosphatidyl-L-serine mislocalised, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 8. with image from Willoughby et al., 2024
long single cone cell cone photoreceptor disc membrane organization quality, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 7. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment decreased diameter, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 7. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor outer segment degenerate, abnormal abca4azf4359/zf4359; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 7. with image from Willoughby et al., 2024
long double cone cell cone photoreceptor outer segment elongated, abnormal abca4azf4360/zf4360; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor outer segment erose, abnormal abca4azf4360/zf4360; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short double cone cell cone photoreceptor outer segment dysplastic, abnormal abca4azf4360/zf4360; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
long single cone cell cone photoreceptor outer segment blunt, abnormal abca4azf4360/zf4360; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short double cone cell phagocytic vesicle decreased amount, abnormal abca4azf4360/zf4360; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment tubular, abnormal abca4azf4360/zf4360; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
long single cone cell cone photoreceptor outer segment tubular, abnormal abca4azf4360/zf4360; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
short single cone cell cone photoreceptor outer segment elongated, abnormal abca4azf4360/zf4360; abca4bzf4361/zf4361; slc45a2b4/b4 standard conditions Fig. 3. with imageFig. 4. with image from Willoughby et al., 2024
Citations