CRISPR

CRISPR3-pomca

ID

ZDB-CRISPR-250415-1

Name

CRISPR3-pomca

Previous Names

None

Target

pomca (1)

Sequence

5' - GGAATCCGCCGAAACGCTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ca404	pomca

Expression

Gene expression in Wild Types + CRISPR3-pomca

No data available

Phenotype

Phenotype resulting from CRISPR3-pomca

No data available

Phenotype of all Fish created by or utilizing CRISPR3-pomca

Phenotype	Fish	Conditions	Figures
whole organism mc4r expression increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 3 from Rajeswari et al., 2024
whole organism pparg expression increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 4 from Rajeswari et al., 2024
hypophysis Ab5-pomc labeling absent, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 1 from Rajeswari et al., 2024
whole organism hsd11b2 expression decreased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 1 from Rajeswari et al., 2024
whole organism nr3c2 expression increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 1 from Rajeswari et al., 2024
whole organism increased weight, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 3 from Rajeswari et al., 2024
whole organism glycerol amount, ameliorated	pomca^ca404/ca404 (TL)	chemical treatment by environment: eplerenone	Fig. 5 from Rajeswari et al., 2024
whole organism triglyceride increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 4 from Rajeswari et al., 2024
brain Ab4-nr3c1 labeling increased amount, abnormal	pomca^ca404/ca404 (TL)	chemical treatment by environment: cortisol	Fig. 1 from Rajeswari et al., 2024
fat cell has extra parts of type fat cell lipid droplet, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 4 from Rajeswari et al., 2024
whole organism nr3c1 expression increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 1 from Rajeswari et al., 2024
whole organism fasn expression increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 4 from Rajeswari et al., 2024
whole organism triglyceride amount, ameliorated	pomca^ca404/ca404 (TL)	chemical treatment by environment: eplerenone	Fig. 5 from Rajeswari et al., 2024
liver Ab4-nr3c1 labeling increased amount, abnormal	pomca^ca404/ca404 (TL)	chemical treatment by environment: cortisol	Fig. 1 from Rajeswari et al., 2024
whole organism cyp11a1.1 expression increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 1 from Rajeswari et al., 2024
whole organism star expression decreased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 1 from Rajeswari et al., 2024
whole organism mc2r expression increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 1 from Rajeswari et al., 2024
liver Ab1-nr3c2 labeling increased amount, abnormal	pomca^ca404/ca404 (TL)	chemical treatment by environment: cortisol	Fig. 1 from Rajeswari et al., 2024
whole organism lpla expression decreased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 4 from Rajeswari et al., 2024
whole organism glycerol increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 4 from Rajeswari et al., 2024
whole organism mc3r expression increased amount, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 3 from Rajeswari et al., 2024
brain Ab1-nr3c2 labeling increased amount, abnormal	pomca^ca404/ca404 (TL)	chemical treatment by environment: cortisol	Fig. 1 from Rajeswari et al., 2024
whole organism decreased pigmentation, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 1 from Rajeswari et al., 2024
hypophysis Ab4-pomc labeling absent, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 1 from Rajeswari et al., 2024
whole organism increased length, abnormal	pomca^ca404/ca404 (TL)	standard conditions	Fig. 3 from Rajeswari et al., 2024

Citations