CRISPR

CRISPR5-il11a

ID
ZDB-CRISPR-250401-1
Name
CRISPR5-il11a
Previous Names
None
Target
Sequence
5' - GGATCAAGTGTTACTCGCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uwk25Tg il11a
Expression
Gene expression in Wild Types + CRISPR5-il11a
No data available
Phenotype
Phenotype resulting from CRISPR5-il11a
No data available
Phenotype of all Fish created by or utilizing CRISPR5-il11a
Phenotype Fish Conditions Figures
cardiac ventricle regenerating tissue EGFP expression increased amount, abnormal il11auwk25Tg/uwk25Tg; ci5Tg/ci5Tg resection: cardiac ventricle Fig. 1 with image from Shin et al., 2024
cardiac ventricle cardiac mesenchymal cell EGFP expression increased amount, abnormal il11auwk25Tg/uwk25Tg; em15Tg/em15Tg standard conditions Fig. 3 with image from Shin et al., 2024
cardiac ventricle peripheral region EGFP expression increased amount, abnormal il11auwk25Tg/uwk25Tg; em15Tg/em15Tg standard conditions Fig. 3 with image from Shin et al., 2024
epicardium Ab2-postn labeling increased amount, abnormal il11auwk25Tg/uwk25Tg; pd108Tg/pd108Tg chemical treatment by environment: tamoxifen Fig. 4 with image from Shin et al., 2024
epicardium ab7-mapk labeling increased amount, abnormal il11auwk25Tg/uwk25Tg; pd108Tg/pd108Tg chemical treatment by environment: tamoxifen Fig. 4 with image from Shin et al., 2024
cardiac ventricle regenerating tissue EGFP expression increased amount, abnormal il11auwk25Tg/uwk25Tg; pd108Tg/pd108Tg resection: cardiac ventricle Fig. 1 with image from Shin et al., 2024
epicardium mCherry expression increased amount, abnormal il11auwk25Tg/uwk25Tg; pd108Tg/pd108Tg chemical treatment by environment: tamoxifen Fig. 4 with image from Shin et al., 2024
cardiac ventricle blood vessel increased amount, abnormal il11auwk25Tg/uwk25Tg; y1Tg/y1Tg standard conditions Fig. 3 with image from Shin et al., 2024
cardiac ventricle peripheral region EGFP expression increased amount, abnormal il11auwk25Tg/uwk25Tg; y1Tg/y1Tg standard conditions Fig. 3 with image from Shin et al., 2024
cardiac ventricle blood vessel EGFP expression increased amount, abnormal il11auwk25Tg/uwk25Tg; y1Tg/y1Tg standard conditions Fig. 3 with image from Shin et al., 2024
epicardium surf1 expression increased amount, abnormal il11auwk25Tg/uwk25Tg; y1Tg/y1Tg resection: cardiac ventricle Fig. 3 with image from Shin et al., 2024
epicardium surf1 expression increased amount, abnormal il11auwk25Tg/uwk25Tg; y1Tg/y1Tg standard conditions Fig. 3 with image from Shin et al., 2024
epicardium thsd7aa expression increased amount, abnormal il11auwk25Tg/uwk25Tg; y1Tg/y1Tg standard conditions Fig. 3 with image from Shin et al., 2024
epicardium angptl2a expression increased amount, abnormal il11auwk25Tg/uwk25Tg; y1Tg/y1Tg resection: cardiac ventricle Fig. 3 with image from Shin et al., 2024
cardiac ventricle peripheral region EGFP expression increased amount, abnormal col12a1bwcm108Tg/wcm108Tg; il11auwk25Tg/uwk25Tg; pd108Tg/pd108Tg standard conditions Fig. 3 with image from Shin et al., 2024
epicardium EGFP expression increased amount, abnormal col12a1bwcm108Tg/wcm108Tg; il11auwk25Tg/uwk25Tg; pd108Tg/pd108Tg standard conditions Fig. 3 with image from Shin et al., 2024
Citations