CRISPR

CRISPR4-arfgef1

ID

ZDB-CRISPR-250127-11

Name

CRISPR4-arfgef1

Previous Names

None

Target

arfgef1 (1)

Sequence

5' - TACACTCTGTGCATCTGCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
chb21	arfgef1

Expression

Gene expression in Wild Types + CRISPR4-arfgef1

No data available

Phenotype

Phenotype resulting from CRISPR4-arfgef1

No data available

Phenotype of all Fish created by or utilizing CRISPR4-arfgef1

Phenotype	Fish	Conditions	Figures
head rpl21 expression decreased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head opn1mw2 expression increased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head arf4b expression increased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head h3f3c expression increased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head tat expression decreased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head cst14a.2 expression increased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
neurotransmitter transport decreased process quality, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head tnfrsf11a expression increased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head atp8a2 expression decreased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head fkbp5 expression decreased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head cyp24a1 expression decreased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
head tagln3b expression decreased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
swimming behavior ictal, abnormal	arfgef1^chb21/chb21	chemical treatment by environment: pentetrazol	Fig. 1 from LaCoursiere et al., 2024
head pdk2b expression decreased amount, abnormal	arfgef1^chb21/chb21	standard conditions	Fig. 4 from LaCoursiere et al., 2024
optic tectum neuronal action potential ictal, abnormal	arfgef1^chb21/+	standard conditions	Fig. 2 from LaCoursiere et al., 2024
optic tectum interneuron GFP expression decreased amount, abnormal	arfgef1^chb21/+; ot1Tg/ot1Tg	standard conditions	Fig. 3 from LaCoursiere et al., 2024
optic tectum GABAergic neuron GFP expression decreased amount, abnormal	arfgef1^chb21/+; ot1Tg/ot1Tg	standard conditions	Fig. 3 from LaCoursiere et al., 2024
optic tectum interneuron GFP expression decreased amount, abnormal	arfgef1^chb21/chb21; ot1Tg/ot1Tg	standard conditions	Fig. 3 from LaCoursiere et al., 2024
optic tectum GABAergic neuron GFP expression decreased amount, abnormal	arfgef1^chb21/chb21; ot1Tg/ot1Tg	standard conditions	Fig. 3 from LaCoursiere et al., 2024

Citations