CRISPR

CRISPR3-borcs8

ID

ZDB-CRISPR-241217-11

Name

CRISPR3-borcs8

Previous Names

None

Target

borcs8 (1)

Sequence

5' - AAGGGCTATTGACGGTTCATTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

No data available

Expression

Gene expression in Wild Types + CRISPR3-borcs8

No data available

Phenotype

Phenotype resulting from CRISPR3-borcs8

No data available

Phenotype of all Fish created by or utilizing CRISPR3-borcs8

Phenotype	Fish	Conditions	Figures
whole organism decreased size, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 6 from De Pace et al., 2023
myotome neuromuscular junction morphology, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 7 from De Pace et al., 2023
swimming decreased occurrence, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 7 from De Pace et al., 2023
myotome decreased size, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 6 from De Pace et al., 2023
myoseptum decreased width, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 6 from De Pace et al., 2023
motor neuron presynaptic active zone physical object quality, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 7 from De Pace et al., 2023
head decreased size, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 6 from De Pace et al., 2023
eye decreased size, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 6 from De Pace et al., 2023
swimming decreased linear velocity, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 7 from De Pace et al., 2023
brain decreased area, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 6 from De Pace et al., 2023
swimming decreased duration, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 7 from De Pace et al., 2023
thigmotaxis decreased process quality, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 7 from De Pace et al., 2023
motor neuron axon decreased branchiness, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 7 from De Pace et al., 2023
whole organism increased curvature, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 6 from De Pace et al., 2023
motor neuron axon decreased length, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 7 from De Pace et al., 2023
myotome neuromuscular junction development decreased occurrence, abnormal	AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. 7 from De Pace et al., 2023
brain decreased size, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. Supplementary 2, Figure 4 from Mencacci et al., 2026
diencephalon Ab13-th labeling decreased distribution, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. Supplementary 2 from Mencacci et al., 2026
brain ab9-mapk labeling increased amount, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	chemical treatment by environment: pentetrazol	Figure 4 from Mencacci et al., 2026
eye decreased area, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. Supplementary 2, Figure 4 from Mencacci et al., 2026
head decreased size, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. Supplementary 2, Figure 4 from Mencacci et al., 2026
primary motor neuron axon ab20-tuba labeling decreased distribution, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. Supplementary 2 from Mencacci et al., 2026
primary motor neuron axon decreased size, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Figure 4 from Mencacci et al., 2026
swimming behavior decreased duration, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Figure 4 from Mencacci et al., 2026
myotome decreased area, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Figure 4 from Mencacci et al., 2026
primary motor neuron axon ab20-tuba labeling spatial pattern, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. Supplementary 2 from Mencacci et al., 2026
brain regulation of action potential decreased process quality, exacerbated	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	chemical treatment by environment: pentetrazol	Figure 4 from Mencacci et al., 2026
whole organism shortened, abnormal	WT + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8	standard conditions	Fig. Supplementary 2, Figure 4 from Mencacci et al., 2026

Citations