CRISPR

CRISPR3-borcs8

ID
ZDB-CRISPR-241217-11
Name
CRISPR3-borcs8
Previous Names
None
Target
Sequence
5' - AAGGGCTATTGACGGTTCATTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR3-borcs8
No data available
Phenotype
Phenotype resulting from CRISPR3-borcs8
No data available
Phenotype of all Fish created by or utilizing CRISPR3-borcs8
Phenotype Fish Conditions Figures
whole organism decreased size, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 6 with image from De Pace et al., 2023
myotome neuromuscular junction morphology, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 7 with image from De Pace et al., 2023
swimming decreased linear velocity, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 7 with image from De Pace et al., 2023
brain decreased area, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 6 with image from De Pace et al., 2023
swimming decreased occurrence, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 7 with image from De Pace et al., 2023
swimming decreased duration, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 7 with image from De Pace et al., 2023
thigmotaxis decreased process quality, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 7 with image from De Pace et al., 2023
myotome decreased size, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 6 with image from De Pace et al., 2023
motor neuron axon decreased branchiness, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 7 with image from De Pace et al., 2023
whole organism increased curvature, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 6 with image from De Pace et al., 2023
myoseptum decreased width, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 6 with image from De Pace et al., 2023
motor neuron presynaptic active zone physical object quality, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 7 with image from De Pace et al., 2023
motor neuron axon decreased length, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 7 with image from De Pace et al., 2023
head decreased size, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 6 with image from De Pace et al., 2023
eye decreased size, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 6 with image from De Pace et al., 2023
myotome neuromuscular junction development decreased occurrence, abnormal AB/TL + CRISPR1-borcs8 + CRISPR2-borcs8 + CRISPR3-borcs8 standard conditions Fig. 7 with image from De Pace et al., 2023
Citations