CRISPR

CRISPR5-foxg1a

ID

ZDB-CRISPR-241204-2

Name

CRISPR5-foxg1a

Previous Names

None

Target

foxg1a (1)

Sequence

5' - GTTGTCGCTTTGCACGGCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "CGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sud24	foxg1a

Expression

Gene expression in Wild Types + CRISPR5-foxg1a

No data available

Phenotype

Phenotype resulting from CRISPR5-foxg1a

No data available

Phenotype of all Fish created by or utilizing CRISPR5-foxg1a

Phenotype	Fish	Conditions	Figures
dorsal telencephalon neurog1 expression increased distribution, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
preoptic area malformed, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 5 , Fig. 6 from Umeda et al., 2024
telencephalon hypotrophic, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 6 from Umeda et al., 2024
preoptic area nkx2.1 expression absent, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
ventral telencephalon dlx2a expression absent, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
dorsal telencephalon neurod1 expression decreased distribution, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
dorsal telencephalon emx1 expression decreased amount, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
liver cell death increased occurrence, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 5 from Umeda et al., 2024
embryonic viscerocranium morphogenesis decreased process quality, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 5 from Umeda et al., 2024
ventral telencephalon gad1b expression absent, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
dorsal telencephalon emx3 expression increased distribution, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
ventral telencephalon emx3 expression mislocalised, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
olfactory placode neurod1 expression decreased amount, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
mandibular arch skeleton hypoplastic, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 5 from Umeda et al., 2024
preoptic area cell death increased occurrence, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 5 from Umeda et al., 2024
dorsal telencephalon tbr1b expression increased amount, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
telencephalon development decreased process quality, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 5 from Umeda et al., 2024
hypothalamus nkx2.4b expression decreased amount, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
dorsal telencephalon neurod1 expression decreased amount, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024
telencephalon decreased thickness, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 5 from Umeda et al., 2024
dorsal telencephalon tbr1b expression increased distribution, abnormal	foxg1a^sud24/sud24	standard conditions	Fig. 7 from Umeda et al., 2024

Citations