CRISPR

CRISPR1-nos2a

ID
ZDB-CRISPR-241023-7
Name
CRISPR1-nos2a
Previous Names
None
Target
Sequence
5' - GGGCCGCGGATCAGAGGTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sou16 nos2a
Expression
Gene expression in Wild Types + CRISPR1-nos2a
No data available
Phenotype
Phenotype resulting from CRISPR1-nos2a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-nos2a
Phenotype Fish Conditions Figures
intestine nitric oxide decreased amount, abnormal nos2asou16/sou16 standard conditions Fig. 1 with image from Huang et al., 2024
intestine adgrf6 expression decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine cd109 expression decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine c6.1 expression increased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine host-mediated modulation of intestinal microbiota composition process quality, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 2 with image,  Fig. 3 with image from Huang et al., 2024
intestine igsf9ba expression increased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine cfb expression increased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine il26 expression increased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine cd28 expression decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine ikbke expression decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine trafd1 expression decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine il13 expression increased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine c3a.1 expression increased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine c8g expression increased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine rgs13a expression decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine cd36 expression decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine cfd expression decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine c5 expression increased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine ier2a expression decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 6 with image from Huang et al., 2024
intestine nitric oxide decreased amount, abnormal nos2asou16/sou16; nos2bsou2/sou2 standard conditions Fig. 1 with image from Huang et al., 2024
Citations