CRISPR

CRISPR5-cdh23

ID
ZDB-CRISPR-240730-4
Name
CRISPR5-cdh23
Previous Names
None
Target
Sequence
5' - GGCGTACACAGGCTCACTCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4078 cdh23
Expression
Gene expression in Wild Types + CRISPR5-cdh23
No data available
Phenotype
Phenotype resulting from CRISPR5-cdh23
No data available
Phenotype of all Fish created by or utilizing CRISPR5-cdh23
Phenotype Fish Conditions Figures
whole organism opn1sw1 expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism prph2a expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism pde6a expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism dead, abnormal cdh23zf4078/zf4078 (TU) standard conditions text only from Yang et al., 2023
whole organism ugt5a2 expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
retina apoptotic process increased occurrence, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 6 with image from Zheng et al., 2025
neuromast hair cell purinergic nucleotide receptor signaling pathway process quality, ameliorated cdh23zf4078/zf4078 (TU) chemical treatment by environment: ATP Figure 7 with image from Yang et al., 2023
whole organism cacng7b expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism cacng5a expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism cacna1fb expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism ppm1nb expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism cts12 expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism cyp26a1 expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism camk1db expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism pde6b expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism si:ch73-167i17.6 expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism rhol expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
auditory receptor cell purinergic nucleotide receptor signaling pathway absent process, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 3 with image from Yang et al., 2023
whole organism cnga1b expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism ugt1b2 expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism camk1gb expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism ppm1na expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism mapkapk2b expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism pklr expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 6 with image from Yang et al., 2023
whole organism pde6c expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism gnat2 expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism p2rx4a expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism myof expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 6 with image from Yang et al., 2023
whole organism mknk2a expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism cyp3a65 expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism arr3a expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism cngb1a expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
neuromast hair cell purinergic nucleotide receptor signaling pathway absent process, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 3 with image,  Figure 7 with image from Yang et al., 2023
post-vent region curved, abnormal cdh23zf4078/zf4078 (TU) standard conditions Fig. S1,  text only from Yang et al., 2023
whole organism grk7a expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism cacna2d4b expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism ugt1a1 expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism myo7bb expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 6 with image from Yang et al., 2023
whole organism ush1c expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 6 with image from Yang et al., 2023
whole organism camk2a expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 8 with image from Zheng et al., 2025
whole organism gucy2f expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism grk1b expression increased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism gck expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 6 with image from Yang et al., 2023
startle response decreased process quality, abnormal cdh23zf4078/zf4078 (TU) vibration Figure 4 with image from Yang et al., 2023
whole organism guca1b expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
whole organism sagb expression decreased amount, abnormal cdh23zf4078/zf4078 (TU) standard conditions Figure 5 with image from Zheng et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.