CRISPR

CRISPR4-nnt

ID
ZDB-CRISPR-240716-6
Name
CRISPR4-nnt
Previous Names
None
Target
Sequence
5' - GGCCTCATGAACTCCTAGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
au111 nnt
Expression
Gene expression in Wild Types + CRISPR4-nnt
No data available
Phenotype
Phenotype resulting from CRISPR4-nnt
No data available
Phenotype of all Fish created by or utilizing CRISPR4-nnt
Phenotype Fish Conditions Figures
Meckel's cartilage hypoplastic, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 2 with image,  Figure 3 with image,  Figure 4 with image from Mazumdar et al., 2023
whole organism reactive oxygen species increased amount, exacerbated nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 5 with image from Mazumdar et al., 2023
ceratohyal cartilage angle ceratohyal cartilage, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 4 with image from Mazumdar et al., 2023
eye decreased size, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 2 with image,  Figure 3 with image,  Figure S1 from Mazumdar et al., 2023
whole organism reactive oxygen species increased amount, abnormal nntau111/au111 (AB) chemical treatment by environment: N-acetyl-L-cysteine Figure 5 with image from Mazumdar et al., 2023
Meckel's cartilage increased width, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 4 with image from Mazumdar et al., 2023
ethmoid cartilage width, ameliorated nntau111/au111 (AB) chemical treatment by environment: ethanol, chemical treatment by environment: N-acetyl-L-cysteine Figure 8 with image from Mazumdar et al., 2023
ceratohyal cartilage deformed, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 2 with image,  Figure 3 with image from Mazumdar et al., 2023
ethmoid cartilage decreased length, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 8 with image from Mazumdar et al., 2023
Meckel's cartilage length, ameliorated nntau111/au111 (AB) chemical treatment by environment: ethanol, chemical treatment by environment: N-acetyl-L-cysteine Figure 8 with image from Mazumdar et al., 2023
ethmoid cartilage decreased width, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 8 with image from Mazumdar et al., 2023
whole organism reactive oxygen species increased amount, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol, chemical treatment by environment: N-acetyl-L-cysteine Figure 5 with image from Mazumdar et al., 2023
whole organism reactive oxygen species amount, ameliorated nntau111/au111 (AB) chemical treatment by environment: N-acetyl-L-cysteine Figure 5 with image from Mazumdar et al., 2023
ethmoid cartilage length, ameliorated nntau111/au111 (AB) chemical treatment by environment: ethanol, chemical treatment by environment: N-acetyl-L-cysteine Figure 8 with image from Mazumdar et al., 2023
whole organism reactive oxygen species increased amount, abnormal nntau111/au111 (AB) control Figure 5 with image from Mazumdar et al., 2023
ethmoid cartilage morphology, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 4 with image from Mazumdar et al., 2023
head decreased size, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 2 with image,  Figure 3 with image from Mazumdar et al., 2023
Meckel's cartilage decreased length, abnormal nntau111/au111 (AB) chemical treatment by environment: ethanol Figure 4 with image,  Figure 8 with image from Mazumdar et al., 2023
pharyngeal arch apoptotic process occurrence, ameliorated nntau111/au111; y1Tg (AB) chemical treatment by environment: ethanol, chemical treatment by environment: N-acetyl-L-cysteine Figure 6 with image from Mazumdar et al., 2023
midbrain hindbrain boundary apoptotic process increased occurrence, abnormal nntau111/au111; y1Tg (AB) chemical treatment by environment: ethanol Figure 6 with image from Mazumdar et al., 2023
pharyngeal arch apoptotic process increased occurrence, exacerbated nntau111/au111; y1Tg (AB) chemical treatment by environment: ethanol Figure 6 with image from Mazumdar et al., 2023
midbrain hindbrain boundary apoptotic process occurrence, ameliorated nntau111/au111; y1Tg (AB) chemical treatment by environment: ethanol, chemical treatment by environment: N-acetyl-L-cysteine Figure 6 with image from Mazumdar et al., 2023
pharyngeal arch apoptotic process increased occurrence, abnormal nntau111/au111; y1Tg (AB) standard conditions Figure 6 with image from Mazumdar et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.