CRISPR

CRISPR5-arnt2

ID
ZDB-CRISPR-240620-7
Name
CRISPR5-arnt2
Previous Names
None
Target
Sequence
5' - GGTCTCGGTCCGTCTAAGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bcm3 arnt2
Expression
Gene expression in Wild Types + CRISPR5-arnt2
No data available
Phenotype
Phenotype resulting from CRISPR5-arnt2
No data available
Phenotype of all Fish created by or utilizing CRISPR5-arnt2
Phenotype Fish Conditions Figures
heart looping decreased process quality, abnormal arnt2bcm3/bcm3 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 7 with image from Edwards et al., 2023
heart edematous, abnormal arnt2bcm3/bcm3 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 7 with image from Edwards et al., 2023
posterior lateral mesoderm lmo2 expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
atrium increased size, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 1 with image from Edwards et al., 2023
dorsal aorta kdrl expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 2 with image from Edwards et al., 2023
anterior lateral plate mesoderm lmo2 expression decreased distribution, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
blood cell decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 1 with image from Edwards et al., 2023
anterior lateral plate mesoderm lmo2 expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
hematopoietic stem cell runx1 expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 2 with image from Edwards et al., 2023
posterior lateral mesoderm tal1 expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
posterior lateral mesoderm tal1 expression decreased distribution, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
dorsal longitudinal anastomotic vessel kdrl expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 2 with image from Edwards et al., 2023
anterior lateral plate mesoderm etsrp expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
posterior lateral mesoderm etsrp expression decreased distribution, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
anterior lateral plate mesoderm tal1 expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
posterior lateral mesoderm lmo2 expression decreased distribution, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
posterior lateral mesoderm etsrp expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
anterior lateral plate mesoderm etsrp expression decreased distribution, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
heart edematous, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 1 with image from Edwards et al., 2023
blood circulation decreased process quality, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 1 with image from Edwards et al., 2023
anterior lateral plate mesoderm tal1 expression decreased distribution, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3 standard conditions Fig. 3 with image from Edwards et al., 2023
caudal vein plexus EGFP expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3; y1Tg/y1Tg standard conditions Fig. 2 with image from Edwards et al., 2023
intersegmental vessel EGFP expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3; y1Tg/y1Tg standard conditions Fig. 2 with image from Edwards et al., 2023
dorsal aorta EGFP expression decreased amount, abnormal arntbcm2/bcm2; arnt2bcm3/bcm3; y1Tg/y1Tg standard conditions Fig. 2 with image from Edwards et al., 2023
Citations