CRISPR

CRISPR1-tnfaip1

ID
ZDB-CRISPR-240619-8
Name
CRISPR1-tnfaip1
Previous Names
None
Target
Sequence
5' - ACCAGCTTCAGCCACACACC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4096 tnfaip1
Expression
Gene expression in Wild Types + CRISPR1-tnfaip1
No data available
Phenotype
Phenotype resulting from CRISPR1-tnfaip1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tnfaip1
Phenotype Fish Conditions Figures
whole organism dhx40 expression increased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
whole organism decreased length, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 3 with image from Huang et al., 2023
whole organism clul1 expression decreased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
hindbrain ccnd1 expression decreased distribution, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 4 with image from Huang et al., 2023
whole organism cryba1a expression decreased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
optic tectum proliferative region ccnd1 expression decreased distribution, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 4 with image from Huang et al., 2023
retina ccnd1 expression decreased distribution, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 4 with image from Huang et al., 2023
head tnfaip1 expression decreased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 2 with image from Huang et al., 2023
whole organism tnfaip1 expression decreased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 2 with image from Huang et al., 2023
whole organism hspb9 expression decreased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
whole organism nppa expression increased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
eye decreased size, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 3 with image from Huang et al., 2023
whole organism lrp2b expression decreased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
whole organism hspa13 expression increased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
whole organism adgrg4a expression decreased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
whole organism tnfrsf19 expression increased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
whole organism zbtb47a expression decreased amount, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 5 with image from Huang et al., 2023
brain neurod1 expression decreased distribution, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 4 with image from Huang et al., 2023
retina tuba1b expression decreased distribution, abnormal tnfaip1zf4096/zf4096 (TU) standard conditions Figure 4 with image from Huang et al., 2023
Citations