CRISPR

CRISPR5-hoxc13a

ID

ZDB-CRISPR-240529-7

Name

CRISPR5-hoxc13a

Previous Names

None

Target

hoxc13a (1)

Sequence

5' - GGAGCGCTAGATGACGTCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
udc5	hoxc13a

Expression

Gene expression in Wild Types + CRISPR5-hoxc13a

No data available

Phenotype

Phenotype resulting from CRISPR5-hoxc13a

No data available

Phenotype of all Fish created by or utilizing CRISPR5-hoxc13a

Phenotype	Fish	Conditions	Figures
caudal fin lower lobe decreased distance caudal fin upper lobe, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 5 from Cumplido et al., 2024
caudal vertebra increased amount, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 3 from Cumplido et al., 2024
caudal fin has fewer parts of type caudal fin procurrent ray, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 2 from Cumplido et al., 2024
hypural 2 decreased distance hypural 3, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 2 from Cumplido et al., 2024
caudal fin principal ray 1 decreased length, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 2 from Cumplido et al., 2024
hypural morphology, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 2 from Cumplido et al., 2024
caudal fin has extra parts of type caudal vertebra, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 2 from Cumplido et al., 2024
post-vent region has extra parts of type somite, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 4 from Cumplido et al., 2024
caudal fin has fewer parts of type caudal fin principal ray, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 2 , Fig. 5 from Cumplido et al., 2024
caudal fin decreased width and length, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 2 from Cumplido et al., 2024
ural vertebra lacks parts or has fewer parts of type uroneural, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 3 from Cumplido et al., 2024
branched caudal fin ray increased amount, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 3 from Cumplido et al., 2024
caudal fin principal ray 1 mislocalised anteriorly, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 2 from Cumplido et al., 2024
caudal fin lacks all parts of type hypural diastema, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 5 from Cumplido et al., 2024
notochord increased length, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 4 from Cumplido et al., 2024
caudal vertebra has extra parts of type hemal spine, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 5 from Cumplido et al., 2024
hypural position, abnormal	hoxc13a^udc5/udc5	standard conditions	Fig. 5 from Cumplido et al., 2024
caudal fin lower lobe decreased distance caudal fin upper lobe, abnormal	hoxc13a^udc5/+	standard conditions	Fig. 2 from Cumplido et al., 2024
caudal fin has fewer parts of type caudal fin procurrent ray, abnormal	hoxc13a^udc5/+	standard conditions	Fig. 2 from Cumplido et al., 2024
caudal fin has fewer parts of type caudal fin principal ray, abnormal	hoxc13a^udc5/+	standard conditions	Fig. 2 from Cumplido et al., 2024
caudal fin lacks all parts of type caudal fin lower lobe, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
post-vent region convolute, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
caudal fin has extra parts of type caudal vertebra, exacerbated	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
preural vertebra curved dorsal, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
whole organism lacks all parts of type hypural, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
caudal fin lacks all parts of type caudal fin upper lobe, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
whole organism lacks all parts of type caudal fin lepidotrichium, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
whole organism lacks all parts of type parhypural, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
whole organism lacks parts or has fewer parts of type lepidotrichium, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
whole organism lacks parts or has fewer parts of type hypural, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024
whole organism lacks parts or has fewer parts of type parhypural, abnormal	hoxc13a^udc5/udc5; hoxb13a^udc4/udc4	standard conditions	Fig. 6 from Cumplido et al., 2024

Citations