CRISPR

CRISPR3-hoxb13a

ID
ZDB-CRISPR-240529-5
Name
CRISPR3-hoxb13a
Previous Names
None
Target
Sequence
5' - GGGCCATGGACAAGGCTAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
udc4 hoxb13a
Expression
Gene expression in Wild Types + CRISPR3-hoxb13a
No data available
Phenotype
Phenotype resulting from CRISPR3-hoxb13a
No data available
Phenotype of all Fish created by or utilizing CRISPR3-hoxb13a
Phenotype Fish Conditions Figures
caudal fin upper lobe has fewer parts of type caudal fin principal ray, abnormal hoxb13audc4/udc4 standard conditions Fig. S5 from Cumplido et al., 2024
caudal fin lower lobe decreased distance caudal fin upper lobe, abnormal hoxb13audc4/udc4 standard conditions Fig. 5 with image from Cumplido et al., 2024
caudal fin has fewer parts of type hypural, abnormal hoxb13audc4/udc4 standard conditions Fig. S7 from Cumplido et al., 2024
hypural morphology, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with image from Cumplido et al., 2024
post-vent region has extra parts of type preural vertebra, abnormal hoxb13audc4/udc4 standard conditions Fig. 5 with image from Cumplido et al., 2024
caudal fin principal ray 1 decreased length, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with image from Cumplido et al., 2024
hypural 2 decreased distance hypural 3, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with image from Cumplido et al., 2024
ural vertebra increased amount, abnormal hoxb13audc4/udc4 standard conditions Fig. 3 with image from Cumplido et al., 2024
caudal fin upper lobe has extra parts of type caudal fin procurrent ray, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with image from Cumplido et al., 2024
post-vent region has extra parts of type somite, abnormal hoxb13audc4/udc4 standard conditions Fig. 4 with image from Cumplido et al., 2024
caudal vertebra increased amount, abnormal hoxb13audc4/udc4 standard conditions Fig. 3 with image from Cumplido et al., 2024
caudal fin has normal numbers of parts of type caudal fin lepidotrichium, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with image from Cumplido et al., 2024
ural vertebra lacks parts or has fewer parts of type uroneural, abnormal hoxb13audc4/udc4 standard conditions Fig. 3 with image from Cumplido et al., 2024
caudal fin has fewer parts of type caudal fin principal ray, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with imageFig. 5 with image from Cumplido et al., 2024
opisthural cartilage absent, abnormal hoxb13audc4/udc4 standard conditions Fig. 5 with imageFig. S7 from Cumplido et al., 2024
caudal vertebra has extra parts of type hemal arch, abnormal hoxb13audc4/udc4 standard conditions Fig. 5 with image from Cumplido et al., 2024
preural 1 vertebra neural spine elongated, abnormal hoxb13audc4/udc4 standard conditions Fig. S7 from Cumplido et al., 2024
caudal fin has extra parts of type ural vertebra 2, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with image from Cumplido et al., 2024
hypural diastema decreased size, abnormal hoxb13audc4/udc4 standard conditions Fig. 5 with image from Cumplido et al., 2024
caudal fin principal ray 1 mislocalised anteriorly, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with image from Cumplido et al., 2024
caudal fin upper lobe decreased length, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with image from Cumplido et al., 2024
notochord posterior region morphology, abnormal hoxb13audc4/udc4 standard conditions Fig. 2 with image from Cumplido et al., 2024
notochord increased length, abnormal hoxb13audc4/udc4 standard conditions Fig. 4 with image from Cumplido et al., 2024
preural vertebra centrum unfused from preural vertebra hemal arch, abnormal hoxb13audc4/udc4 standard conditions Fig. S7 from Cumplido et al., 2024
caudal vertebra has extra parts of type hemal spine, abnormal hoxb13audc4/udc4 standard conditions Fig. 5 with image from Cumplido et al., 2024
hypural position, abnormal hoxb13audc4/udc4 standard conditions Fig. 5 with image from Cumplido et al., 2024
preural vertebra centrum unfused from preural vertebra hemal arch, abnormal hoxb13audc4/+ standard conditions Fig. S7 from Cumplido et al., 2024
caudal fin lacks all parts of type caudal fin lower lobe, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
post-vent region convolute, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
caudal fin decreased width and length, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. S8 from Cumplido et al., 2024
caudal fin skeleton neural spine fused with caudal fin hemal spine, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. S8 from Cumplido et al., 2024
caudal fin has extra parts of type caudal vertebra, exacerbated hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
preural vertebra curved dorsal, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
whole organism lacks all parts of type hypural, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
caudal fin lacks all parts of type caudal fin upper lobe, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
whole organism lacks all parts of type caudal fin lepidotrichium, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
whole organism lacks all parts of type parhypural, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
whole organism lacks parts or has fewer parts of type lepidotrichium, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
whole organism lacks parts or has fewer parts of type hypural, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with imageFig. S8 from Cumplido et al., 2024
whole organism lacks parts or has fewer parts of type parhypural, abnormal hoxc13audc5/udc5; hoxb13audc4/udc4 standard conditions Fig. 6 with image from Cumplido et al., 2024
Citations