CRISPR

CRISPR4-npc1

ID
ZDB-CRISPR-240509-26
Name
CRISPR4-npc1
Previous Names
None
Target
Sequence
5' - GGAAGACGTAAAACACACTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3970 npc1
zf3971 npc1
Expression
Gene expression in Wild Types + CRISPR4-npc1
No data available
Phenotype
Phenotype resulting from CRISPR4-npc1
No data available
Phenotype of all Fish created by or utilizing CRISPR4-npc1
Phenotype Fish Conditions Figures
intestine Ab2-npc1 labeling absent, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 6 with image from Quelle-Regaldie et al., 2023
swimming behavior decreased process quality, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 8 with image from Quelle-Regaldie et al., 2023
enterocyte lipid increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
liver sphingomyelin increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 7 with image from Quelle-Regaldie et al., 2023
whole organism sphingomyelin increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 11 with image from Quelle-Regaldie et al., 2023
whole organism viability, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 2 with image from Quelle-Regaldie et al., 2023
liver Ab2-npc1 labeling absent, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 6 with image from Quelle-Regaldie et al., 2023
whole organism dead, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 2 with image from Quelle-Regaldie et al., 2023
whole organism cholesteryl ester decreased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 11 with image from Quelle-Regaldie et al., 2023
whole organism decreased length, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 3 with image from Quelle-Regaldie et al., 2023
enterocyte vacuole increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
grey matter vacuole increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
liver cholesterol increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 7 with image from Quelle-Regaldie et al., 2023
hepatocyte lipid increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 4 with image,  Figure 5 with image from Quelle-Regaldie et al., 2023
whole organism phosphatidylinositol increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 11 with image from Quelle-Regaldie et al., 2023
hepatocyte vacuole increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 4 with image,  Figure 5 with image from Quelle-Regaldie et al., 2023
central nervous system Ab2-npc1 labeling absent, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 6 with image from Quelle-Regaldie et al., 2023
renal tubule Ab2-npc1 labeling absent, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 6 with image from Quelle-Regaldie et al., 2023
renal tubule vacuole increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
whole organism phosphatidylglycerol increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 11 with image from Quelle-Regaldie et al., 2023
renal tubule lipid increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
intestine cholesterol increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 7 with image from Quelle-Regaldie et al., 2023
whole organism phosphatidate(2-) decreased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 11 with image from Quelle-Regaldie et al., 2023
whole organism N-heptadecanoyl-15-methylhexadecasphingosine-1-phosphocholine increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 13 with image from Quelle-Regaldie et al., 2023
grey matter lipid increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
intestine sphingomyelin increased amount, abnormal npc1zf3970/zf3970 (AB) standard conditions Figure 7 with image from Quelle-Regaldie et al., 2023
intestine Ab2-npc1 labeling absent, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 6 with image from Quelle-Regaldie et al., 2023
enterocyte lipid increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
swimming behavior decreased process quality, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 8 with image from Quelle-Regaldie et al., 2023
liver sphingomyelin increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 7 with image from Quelle-Regaldie et al., 2023
whole organism viability, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 2 with image from Quelle-Regaldie et al., 2023
liver Ab2-npc1 labeling absent, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 6 with image from Quelle-Regaldie et al., 2023
whole organism dead, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 2 with image from Quelle-Regaldie et al., 2023
whole organism decreased length, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 3 with image from Quelle-Regaldie et al., 2023
hepatocyte lipid increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 4 with image,  Figure 5 with image from Quelle-Regaldie et al., 2023
enterocyte vacuole increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
grey matter vacuole increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
liver cholesterol increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 7 with image from Quelle-Regaldie et al., 2023
hepatocyte vacuole increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 4 with image,  Figure 5 with image from Quelle-Regaldie et al., 2023
central nervous system Ab2-npc1 labeling absent, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 6 with image from Quelle-Regaldie et al., 2023
renal tubule Ab2-npc1 labeling absent, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 6 with image from Quelle-Regaldie et al., 2023
renal tubule lipid increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
intestine cholesterol increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 7 with image from Quelle-Regaldie et al., 2023
renal tubule vacuole increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
grey matter lipid increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 5 with image from Quelle-Regaldie et al., 2023
intestine sphingomyelin increased amount, abnormal npc1zf3971/zf3971 (AB) standard conditions Figure 7 with image from Quelle-Regaldie et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.