CRISPR

CRISPR5-hes1

ID
ZDB-CRISPR-240220-2
Name
CRISPR5-hes1
Previous Names
  • CRISPR5-her6
Target
Sequence
5' - TCGGTACTTCCCAAGAACGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
co3005 hes1
Expression
Gene expression in Wild Types + CRISPR5-hes1
No data available
Phenotype
Phenotype resulting from CRISPR5-hes1
No data available
Phenotype of all Fish created by or utilizing CRISPR5-hes1
Phenotype Fish Conditions Figures
ceratohyal cartilage position, abnormal hes4co66/co66; hes1co3005/co3005 standard conditions Figure 8 with image from Stenzel et al., 2022
lens duplicated, abnormal hes4co66/co66; hes1co3005/co3005 standard conditions Figure 8 with image from Stenzel et al., 2022
opercle bone mineralization decreased process quality, abnormal hes4co66/co66; hes1co3005/co3005 standard conditions Figure 8 with image from Stenzel et al., 2022
hyomandibular foramen morphology, abnormal jag1bb1105/b1105; hes1co3005/+ standard conditions Figure 8 with image from Stenzel et al., 2022
palatoquadrate cartilage decreased size, abnormal jag1bb1105/b1105; hes1co3005/+ standard conditions Figure 8 with image from Stenzel et al., 2022
opercle decreased size, abnormal jag1bb1105/b1105; hes1co3005/+ standard conditions Figure 8 with image from Stenzel et al., 2022
hyomandibular foramen morphology, abnormal jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 8 with image from Stenzel et al., 2022
palatoquadrate cartilage decreased size, abnormal jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 8 with image from Stenzel et al., 2022
opercle decreased size, abnormal jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 8 with image from Stenzel et al., 2022
pharyngeal arch 2 dorsal region dlx5a expression mislocalised, abnormal hes4co66/+; jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 9 with image from Stenzel et al., 2022
pharyngeal arch 2 ventral region dlx5a expression absent, abnormal hes4co66/+; jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 9 with image from Stenzel et al., 2022
dorsal/ventral pattern formation process characteristic, abnormal hes4co66/+; jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 9 with image from Stenzel et al., 2022
branchiostegal ray fan-shaped, abnormal hes4co66/+; jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 9 with image from Stenzel et al., 2022
opercle linear, abnormal hes4co66/+; jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 9 with image from Stenzel et al., 2022
branchiostegal ray fused with opercle, abnormal hes4co66/+; jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 9 with image from Stenzel et al., 2022
branchiostegal ray distended, abnormal hes4co66/+; jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure 9 with image from Stenzel et al., 2022
whole organism chordate embryonic development delayed, abnormal hes4co66/co66; jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure S6 from Stenzel et al., 2022
whole organism edematous, abnormal hes4co66/co66; jag1bb1105/b1105; hes1co3005/co3005 standard conditions Figure S6 from Stenzel et al., 2022
Citations