CRISPR

CRISPR10-sox10

ID
ZDB-CRISPR-240207-12
Name
CRISPR10-sox10
Previous Names
None
Target
Sequence
5' - GGGTCGTGGTGACCTAGTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ci3020 sox10
Expression
Gene expression in Wild Types + CRISPR10-sox10
No data available
Phenotype
Phenotype resulting from CRISPR10-sox10
No data available
Phenotype of all Fish created by or utilizing CRISPR10-sox10
Phenotype Fish Conditions Figures
whole organism calcium atom decreased amount, abnormal sox10ci3020/ci3020 standard conditions Fig. 2. with imageFig. 7. with image from Gjorcheska et al., 2025
NaK ionocyte decreased amount, abnormal sox10ci3020/ci3020 standard conditions Fig. 7. with image from Gjorcheska et al., 2025
pigmentation absent process, abnormal sox10ci3020/ci3020 standard conditions Fig. 7. with image from Gjorcheska et al., 2025
whole organism stc1l expression increased amount, abnormal sox10ci3020/ci3020 standard conditions Fig. 5. with image from Gjorcheska et al., 2025
ionocyte decreased amount, abnormal sox10ci3020/ci3020 standard conditions Fig. 4. with image from Gjorcheska et al., 2025
whole organism calcium atom decreased amount, abnormal sox10ci3020/ci3020 chemical treatment by environment: calcium dichloride Fig. 2. with image from Gjorcheska et al., 2025
ionocyte igfbp5a expression decreased amount, abnormal sox10ci3020/ci3020 standard conditions Fig. 4. with image from Gjorcheska et al., 2025
bone mineralization delayed, abnormal sox10ci3020/ci3020 standard conditions Fig. 1. with imageFig. 7. with image from Gjorcheska et al., 2025
bone mineralization delayed, abnormal sox10ci3020/ci3020 chemical treatment by environment: calcium dichloride Fig. 2. with image from Gjorcheska et al., 2025
inner ear malformed, abnormal sox10ci3020/ci3020 standard conditions Fig. 7. with image from Gjorcheska et al., 2025
corpuscles of Stannius increased size, abnormal sox10ci3020/ci3020 standard conditions Fig. 6. with image from Gjorcheska et al., 2025
corpuscles of Stannius stc1l expression increased amount, abnormal sox10ci3020/ci3020 standard conditions Fig. 5. with image from Gjorcheska et al., 2025
ionocyte trpv6 expression decreased amount, abnormal sox10ci3020/ci3020 standard conditions Fig. 4. with image from Gjorcheska et al., 2025
ceratobranchial cartilage absent, abnormal sox10ci3020/+; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
hyomandibula malformed, abnormal sox10ci3020/+; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
ectomesenchyme sox9a expression decreased amount, abnormal sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
ectomesenchyme dlx2a expression decreased amount, abnormal sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
ectomesenchyme twist1a expression decreased amount, abnormal sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
ceratobranchial cartilage absent, abnormal sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
hyomandibula malformed, abnormal sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
heart edematous, abnormal sox10ci3020/ci3020; stc1lmi610/mi610 standard conditions Fig. 7. with image from Gjorcheska et al., 2025
pigmentation absent process, abnormal sox10ci3020/ci3020; stc1lmi610/mi610 standard conditions Fig. 7. with image from Gjorcheska et al., 2025
whole organism calcium atom amount, ameliorated sox10ci3020/ci3020; stc1lmi610/mi610 standard conditions Fig. 7. with image from Gjorcheska et al., 2025
inner ear malformed, abnormal sox10ci3020/ci3020; stc1lmi610/mi610 standard conditions Fig. 7. with image from Gjorcheska et al., 2025
NaK ionocyte amount, ameliorated sox10ci3020/ci3020; stc1lmi610/mi610 standard conditions Fig. 7. with image from Gjorcheska et al., 2025
bone mineralization process quality, ameliorated sox10ci3020/ci3020; stc1lmi610/mi610 standard conditions Fig. 7. with image from Gjorcheska et al., 2025
hyomandibula present, ameliorated nr2f2ci3005/ci3005; sox10ci3020/+; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
ceratobranchial cartilage present, ameliorated nr2f2ci3005/ci3005; sox10ci3020/+; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
ectomesenchyme sox9a expression decreased amount, abnormal nr2f2ci3005/ci3005; sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
hyomandibula present, ameliorated nr2f2ci3005/ci3005; sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
ectomesenchyme dlx2a expression decreased amount, abnormal nr2f2ci3005/ci3005; sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
ectomesenchyme twist1a expression decreased amount, abnormal nr2f2ci3005/ci3005; sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
ceratobranchial cartilage present, ameliorated nr2f2ci3005/ci3005; sox10ci3020/ci3020; nr2f5ci3000/ci3000 standard conditions Fig. 4 with image from Okeke et al., 2022
Citations