CRISPR

CRISPR1-vip

ID
ZDB-CRISPR-230926-1
Name
CRISPR1-vip
Previous Names
None
Target
Sequence
5' - AAAGCAATGCTTGTGCGGAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3996 vip
Expression
Gene expression in Wild Types + CRISPR1-vip
No data available
Phenotype
Phenotype resulting from CRISPR1-vip
No data available
Phenotype of all Fish created by or utilizing CRISPR1-vip
Phenotype Fish Conditions Figures
male organism decreased male fertility, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 1 with image from Yu et al., 2024
female organism proximal pars anterior vip expression absent, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 5 from Tanaka et al., 2022
testis decreased size, abnormal vipzf3996/zf3996 (TU) chemical treatment by environment: methyltestosterone Fig. 3 with image from Yu et al., 2024
testis decreased size, abnormal vipzf3996/zf3996 (TU) control Fig. 3 with image from Yu et al., 2024
male organism decreased fecundity, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 1 with image from Yu et al., 2024
testis hsd17b3 expression decreased amount, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 6 with image from Yu et al., 2024
Sertoli cell vip expression absent, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 5 with image from Yu et al., 2024
spermatid decreased amount, abnormal vipzf3996/zf3996 (TU) control Fig. 3 with image from Yu et al., 2024
spermatocyte vip expression absent, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 5 with image from Yu et al., 2024
testis cyp11c1 expression decreased amount, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 6 with image from Yu et al., 2024
spermatid decreased amount, abnormal vipzf3996/zf3996 (TU) chemical treatment by environment: methyltestosterone Fig. 3 with image from Yu et al., 2024
male mating behavior decreased process quality, abnormal vipzf3996/zf3996 (TU) control Fig. 2 with image from Yu et al., 2024
testis hsd17b1 expression decreased amount, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 6 with image from Yu et al., 2024
male organism ratio female organism, ameliorated vipzf3996/zf3996 (TU) chemical treatment by environment: methyltestosterone Table 2 from Yu et al., 2024
female organism postcommissural nucleus of ventral telencephalon vip expression absent, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 5 from Tanaka et al., 2022
sperm decreased cellular motility, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 4 with image from Yu et al., 2024
female organism rostral parvocellular preoptic nucleus vip expression absent, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 5 from Tanaka et al., 2022
spermatogonium vip expression absent, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 5 with image from Yu et al., 2024
testis 11-oxotestosterone absence of physical object, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 6 with image from Yu et al., 2024
Leydig cell vip expression absent, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 5 with image from Yu et al., 2024
testis decreased concentration sperm, abnormal vipzf3996/zf3996 (TU) standard conditions Fig. 4 with image from Yu et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.