CRISPR

CRISPR2-fosab

ID

ZDB-CRISPR-230919-6

Name

CRISPR2-fosab

Previous Names

None

Target

fosab (1)

Sequence

5' - GGTTGGGGAATTCAAGGAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

No data available

Expression

Gene expression in Wild Types + CRISPR2-fosab

No data available

Phenotype

Phenotype resulting from CRISPR2-fosab

No data available

Phenotype of all Fish created by or utilizing CRISPR2-fosab

Phenotype	Fish	Conditions	Figures
ceratobranchial 5 tooth decreased amount, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
cleithrum decreased size, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
parasphenoid ossification process quality, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
tooth 3V absent, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
pericardium edematous, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
head decreased size, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
neuromast fused with neuromast, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
ventral mandibular arch morphology, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
tooth 4V morphology, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
mouth shape, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
whole organism lacks all parts of type swim bladder, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
head cell death increased occurrence, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 6 from Maili et al., 2023
ethmoid cartilage decreased size, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
opercle decreased size, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
branchiostegal ray ossification process quality, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
ceratobranchial 5 bone bone mineralization decreased process quality, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
palatoquadrate cartilage decreased size, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
eye decreased size, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
tooth 5V absent, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
neuromast mislocalised, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
basibranchial decreased amount, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
tooth 4V decreased size, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
Meckel's cartilage decreased size, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
whole organism anterior-posterior axis increased curvature, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
extension morphology, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 2 from Maili et al., 2023
head fosab expression decreased amount, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE S1 from Maili et al., 2023
parachordal cartilage decreased size, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
ceratobranchial 5 bone ossification process quality, abnormal	WT + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 4 from Maili et al., 2023
pharyngeal arch 1 fused with pharyngeal arch 2, abnormal	ba2Tg + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE S10 from Maili et al., 2023
pharyngeal arch 2 morphology, abnormal	ba2Tg + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE S10 from Maili et al., 2023
neural crest cell migration disrupted, abnormal	ba2Tg + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 6 from Maili et al., 2023
pharyngeal arch 3-7 shape, abnormal	ba2Tg + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE S10 from Maili et al., 2023
pharyngeal arch 1 morphology, abnormal	ba2Tg + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE S10 from Maili et al., 2023
olfactory pit decreased size, abnormal	gz7Tg + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 5 from Maili et al., 2023
oral epithelium epithelial cell spatial pattern, abnormal	gz7Tg + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 5 from Maili et al., 2023
oral cavity decreased size, abnormal	gz7Tg + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 5 from Maili et al., 2023
oral epithelium epithelial cell decreased size, abnormal	gz7Tg + CRISPR1-fosab + CRISPR2-fosab	standard conditions	FIGURE 5 from Maili et al., 2023

Citations