CRISPR

CRISPR16-tp53

ID

ZDB-CRISPR-230411-4

Name

CRISPR16-tp53

Previous Names

None

Target

tp53 (1)

Sequence

5' - GGGTGGACGTTGCCCCTCCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

Tg(ubb:LOXP-STOP-LOXP-Cas9-2A-mCherry,linc.u6:CRISPR16-tp53)

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3638	tp53

Expression

Gene expression in Wild Types + CRISPR16-tp53

No data available

Phenotype

Phenotype resulting from CRISPR16-tp53

No data available

Phenotype of all Fish created by or utilizing CRISPR16-tp53

Phenotype	Fish	Conditions	Figures
liver ab11-tp53 labeling spatial pattern, abnormal	tp53^{zf3638/zf3638}	standard conditions	Fig. 2 from Luo et al., 2021
liver ab11-tp53 labeling decreased amount, abnormal	tp53^{zf3638/zf3638}	standard conditions	Fig. 2 from Luo et al., 2021
liver tp53 expression decreased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
vasculature hepatocellular carcinoma neoplastic, invasive, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver hepatocellular carcinoma neoplastic, malignant, ameliorated	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	chemical treatment by environment: MK-2206	Fig. 6 from Luo et al., 2021
liver Ab5-glul labeling increased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 , Fig. 5 from Luo et al., 2021
whole organism viability, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver Ab18-pcna labeling increased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 , Fig. 5 from Luo et al., 2021
liver ptena expression decreased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver ab5-akt labeling amount, ameliorated	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	chemical treatment by environment: MK-2206	Fig. 6 from Luo et al., 2021
liver hepatocellular carcinoma increased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver hepatocellular carcinoma proliferative, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 6 from Luo et al., 2021
liver vasculature dysplastic, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver ptenb expression decreased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver common bile duct absent, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
hepatocyte lipid storage decreased process quality, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver hepatocellular carcinoma increased amount, exacerbated	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 5 from Luo et al., 2021
liver hepatocellular carcinoma neoplastic, malignant, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 6 from Luo et al., 2021
liver Ab5-glul labeling amount, ameliorated	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	chemical treatment by environment: MK-2206	Fig. 6 from Luo et al., 2021
cholangiocyte Ab2-krt19 labeling decreased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver hyperplastic, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver Ab4-pten labeling decreased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 , Fig. 6 from Luo et al., 2021
liver hepatocellular carcinoma proliferative, ameliorated	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	chemical treatment by environment: MK-2206	Fig. 6 from Luo et al., 2021
liver ab11-tp53 labeling decreased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver ab5-akt labeling increased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 , Fig. 5 , Fig. 6 from Luo et al., 2021
liver Ab18-pcna labeling amount, ameliorated	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	chemical treatment by environment: MK-2206	Fig. 6 from Luo et al., 2021
liver necrotic, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
pancreas hepatocellular adenoma neoplastic, invasive, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 4 from Luo et al., 2021
liver Ab5-akt1 labeling decreased amount, abnormal	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 6 from Luo et al., 2021
liver hepatocellular carcinoma proliferative, exacerbated	ptena^{zf3641/zf3641}; ptenb^{zf3644/zf3644}; tp53^{zf3638/zf3638}	standard conditions	Fig. 5 from Luo et al., 2021

Citations