CRISPR

CRISPR3-lrp5

ID
ZDB-CRISPR-230124-1
Name
CRISPR3-lrp5
Previous Names
None
Target
Sequence
5' - TTACTCGCCGATGGACATCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR3-lrp5
No data available
Phenotype
Phenotype resulting from CRISPR3-lrp5
Phenotype Fish Figures
bone tissue calcium cation decreased amount, abnormal AB + CRISPR3-lrp5 Fig. 4 from Bek et al., 2021
bone tissue magnesium cation decreased amount, abnormal AB + CRISPR3-lrp5 Fig. 4 from Bek et al., 2021
bone tissue phosphate decreased amount, abnormal AB + CRISPR3-lrp5 Fig. 4 from Bek et al., 2021
caudal fin Ab1-lrp5 labeling decreased amount, abnormal AB + CRISPR3-lrp5 Fig. 1 from Bek et al., 2021
centrum decreased mass density, abnormal AB + CRISPR3-lrp5 Fig. 4 from Bek et al., 2021
centrum decreased volume, abnormal AB + CRISPR3-lrp5 Fig. 4 from Bek et al., 2021
ceratobranchial cartilage decreased length, abnormal AB + CRISPR3-lrp5 Fig. 2 from Bek et al., 2021
ceratobranchial cartilage increased angle to ceratobranchial cartilage, abnormal AB + CRISPR3-lrp5 Fig. 2 from Bek et al., 2021
ceratohyal bone increased angle to ceratohyal bone, abnormal AB + CRISPR3-lrp5 Fig. 4 from Bek et al., 2021
ceratohyal cartilage decreased length, abnormal AB + CRISPR3-lrp5 Fig. 2 from Bek et al., 2021
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal AB + CRISPR3-lrp5 Fig. 2 from Bek et al., 2021
head decreased length, abnormal AB + CRISPR3-lrp5 Fig. 2,  Fig. 4 from Bek et al., 2021
Meckel's cartilage decreased length, abnormal AB + CRISPR3-lrp5 Fig. 2 from Bek et al., 2021
notochord bone mineralization decreased process quality, abnormal AB + CRISPR3-lrp5 Fig. 3 from Bek et al., 2021
Phenotype of all Fish created by or utilizing CRISPR3-lrp5
Phenotype Fish Conditions Figures
caudal fin Ab1-lrp5 labeling decreased amount, abnormal AB + CRISPR3-lrp5 control Fig. 1 from Bek et al., 2021
head decreased length, abnormal AB + CRISPR3-lrp5 control Fig. 2,  Fig. 4 from Bek et al., 2021
notochord bone mineralization decreased process quality, abnormal AB + CRISPR3-lrp5 control Fig. 3 from Bek et al., 2021
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal AB + CRISPR3-lrp5 standard conditions Fig. 2 from Bek et al., 2021
bone tissue magnesium cation decreased amount, abnormal AB + CRISPR3-lrp5 control Fig. 4 from Bek et al., 2021
notochord bone mineralization process quality, ameliorated AB + CRISPR3-lrp5 chemical treatment by environment: calcitriol Fig. 3 from Bek et al., 2021
Meckel's cartilage decreased length, abnormal AB + CRISPR3-lrp5 standard conditions Fig. 2 from Bek et al., 2021
centrum decreased volume, abnormal AB + CRISPR3-lrp5 control Fig. 4 from Bek et al., 2021
centrum decreased mass density, abnormal AB + CRISPR3-lrp5 control Fig. 4 from Bek et al., 2021
caudal fin principal ray disorganized, abnormal AB + CRISPR3-lrp5 amputation: caudal fin Fig. 5 from Bek et al., 2021
ceratohyal cartilage decreased length, abnormal AB + CRISPR3-lrp5 standard conditions Fig. 2 from Bek et al., 2021
ceratobranchial cartilage decreased length, abnormal AB + CRISPR3-lrp5 standard conditions Fig. 2 from Bek et al., 2021
ceratohyal bone increased angle to ceratohyal bone, abnormal AB + CRISPR3-lrp5 control Fig. 4 from Bek et al., 2021
bone tissue phosphate decreased amount, abnormal AB + CRISPR3-lrp5 control Fig. 4 from Bek et al., 2021
bone tissue calcium cation decreased amount, abnormal AB + CRISPR3-lrp5 control Fig. 4 from Bek et al., 2021
ceratobranchial cartilage increased angle to ceratobranchial cartilage, abnormal AB + CRISPR3-lrp5 standard conditions Fig. 2 from Bek et al., 2021
caudal fin blastema GFP expression decreased distribution, abnormal ia4Tg + CRISPR3-lrp5 (AB) amputation: caudal fin Fig. 5 from Bek et al., 2021
caudal fin blastema dkk1b expression decreased amount, abnormal ia4Tg + CRISPR3-lrp5 (AB) amputation: caudal fin Fig. 5 from Bek et al., 2021
caudal fin blastema axin2 expression decreased amount, abnormal ia4Tg + CRISPR3-lrp5 (AB) amputation: caudal fin Fig. 5 from Bek et al., 2021
caudal fin blastema lef1 expression decreased amount, abnormal ia4Tg + CRISPR3-lrp5 (AB) amputation: caudal fin Fig. 5 from Bek et al., 2021
caudal fin blastema tcf7 expression decreased amount, abnormal ia4Tg + CRISPR3-lrp5 (AB) amputation: caudal fin Fig. 5 from Bek et al., 2021
caudal fin blastema dkk1a expression decreased amount, abnormal ia4Tg + CRISPR3-lrp5 (AB) amputation: caudal fin Fig. 5 from Bek et al., 2021
caudal fin blastema GFP expression decreased distribution, abnormal pd64Tg + CRISPR3-lrp5 (AB) amputation: caudal fin Fig. 5 from Bek et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.