CRISPR

CRISPR1-slc38a9

ID

ZDB-CRISPR-221206-7

Name

CRISPR1-slc38a9

Previous Names

None

Target

slc38a9 (1)

Sequence

5' - AGGACAGTAAACCGTTACTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ouc101	slc38a9
ouc102	slc38a9

Expression

Gene expression in Wild Types + CRISPR1-slc38a9

No data available

Phenotype

Phenotype resulting from CRISPR1-slc38a9

No data available

Phenotype of all Fish created by or utilizing CRISPR1-slc38a9

Phenotype	Fish	Conditions	Figures
whole organism dead, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 2 from Wu et al., 2022
pericardium edematous, exacerbated	slc38a9^{ouc101/ouc101}	hypoxia	Figure 7 from Wu et al., 2022
whole organism hhip expression increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 3 from Wu et al., 2022
whole organism slc38a9 expression decreased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 2 from Wu et al., 2022
eye decreased size, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 2 , Figure 7 from Wu et al., 2022
whole organism apoptotic process increased process quality, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 4 from Wu et al., 2022
whole organism cnot1 expression decreased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 3 from Wu et al., 2022
whole organism lactate increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 6 from Wu et al., 2022
whole organism gpt2 expression increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism kars1 expression increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 3 from Wu et al., 2022
whole organism igfbp1a expression increased amount, abnormal	slc38a9^{ouc101/ouc101}	hypoxia	Figure 7 from Wu et al., 2022
whole organism viability, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 2 from Wu et al., 2022
whole organism alanine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism leucine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism pyruvate decreased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 6 from Wu et al., 2022
whole organism histidine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism semi-viable, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 2 from Wu et al., 2022
whole organism serine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism methionine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism tyrosine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism glucose decreased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 6 from Wu et al., 2022
whole organism vegfaa expression increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 7 from Wu et al., 2022
whole organism D-glucose 6-phosphate decreased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 6 from Wu et al., 2022
whole organism thrb expression decreased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 3 from Wu et al., 2022
whole organism length, exacerbated	slc38a9^{ouc101/ouc101}	hypoxia	Figure 7 from Wu et al., 2022
whole organism decreased length, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 2 , Figure 7 from Wu et al., 2022
whole organism ddit4 expression increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 7 from Wu et al., 2022
whole organism glycine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism got2b expression decreased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism lysine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism valine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism ddit4 expression amount, ameliorated	slc38a9^{ouc101/ouc101}	hypoxia	Figure 7 from Wu et al., 2022
pericardium edematous, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 2 , Figure 7 from Wu et al., 2022
whole organism threonine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism igfbp1a expression increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 3 , Figure 7 from Wu et al., 2022
whole organism eif2s1b expression increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 3 from Wu et al., 2022
whole organism isoleucine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
eye size, exacerbated	slc38a9^{ouc101/ouc101}	hypoxia	Figure 7 from Wu et al., 2022
heart contraction decreased rate, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 3 from Wu et al., 2022
whole organism hmox1a expression increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 7 from Wu et al., 2022
whole organism phenylalanine increased amount, abnormal	slc38a9^{ouc101/ouc101}	standard conditions	Figure 5 from Wu et al., 2022
whole organism slc38a9 expression decreased amount, abnormal	slc38a9^{ouc102/ouc102}	standard conditions	Figure 2 from Wu et al., 2022

Citations