CRISPR

CRISPR2-rasip1

ID
ZDB-CRISPR-221129-2
Name
CRISPR2-rasip1
Previous Names
  • Cris7 (1)
Target
Sequence
5' - TGAAGCTCAGGGCTGGGGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ubs28 rasip1
Expression
Gene expression in Wild Types + CRISPR2-rasip1
No data available
Phenotype
Phenotype resulting from CRISPR2-rasip1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-rasip1
Phenotype Fish Conditions Figures
dorsal longitudinal anastomotic vessel lumen malformed, abnormal rasip1ubs28/ubs28; nkuasrfp1aTg; ubs3Tg standard conditions Fig. 5. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel has extra parts of type dorsal longitudinal anastomotic vessel intracellular vesicle, abnormal rasip1ubs28/ubs28; nkuasrfp1aTg; ubs3Tg standard conditions Fig. 5. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel blood vessel lumenization decreased process quality, abnormal rasip1ubs28/ubs28; nkuasrfp1aTg; ubs3Tg standard conditions Fig. 5. with image from Lee et al., 2021
blood circulation decreased process quality, abnormal rasip1ubs28/ubs28; nkuasrfp1aTg; ubs3Tg; uq11bhTg standard conditions Fig. 7. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel has extra parts of type dorsal longitudinal anastomotic vessel intracellular vesicle, abnormal rasip1ubs28/ubs28; nkuasrfp1aTg; ubs3Tg; uq11bhTg standard conditions Fig. 5. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel blood vessel lumenization decreased process quality, abnormal rasip1ubs28/ubs28; nkuasrfp1aTg; ubs3Tg; uq11bhTg standard conditions Fig. 5. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel lumen malformed, abnormal rasip1ubs28/ubs28; nkuasrfp1aTg; ubs3Tg; uq11bhTg standard conditions Fig. 5. with image from Lee et al., 2021
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal rasip1ubs28/ubs28; s843Tg standard conditions Fig. 1. with imageFig. 2. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel blood vessel lumenization decreased process quality, abnormal rasip1ubs28/ubs28; s843Tg standard conditions Fig. 5. with image from Lee et al., 2021
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal rasip1ubs28/ubs28; s843Tg standard conditions Fig. 2. with imageFig. 7. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel lumen closed, abnormal rasip1ubs28/ubs28; s843Tg standard conditions Fig. 5. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel lumen malformed, abnormal rasip1ubs28/ubs28; s843Tg standard conditions Fig. 5. with image from Lee et al., 2021
dorsal longitudinal anastomotic vessel lumen mislocalised, abnormal rasip1ubs28/ubs28; s843Tg standard conditions Fig. 5. with image from Lee et al., 2021
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal rasip1ubs28/ubs28; s843Tg standard conditions Fig. 1. with image from Lee et al., 2021
intersegmental vessel blood vessel lumenization delayed, abnormal rasip1ubs28/ubs28; s843Tg; sd2Tg standard conditions Fig. 4. with image from Lee et al., 2021
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal rasip1ubs28/ubs28; uq11bhTg standard conditions Fig. 1. with image from Lee et al., 2021
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal rasip1ubs28/ubs28; uq11bhTg standard conditions Fig. 1. with image from Lee et al., 2021
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal rasip1ubs28/ubs28; uq11bhTg standard conditions Fig. 1. with image from Lee et al., 2021
blood circulation decreased process quality, abnormal radil2asa20161/sa20161; rasip1ubs28/ubs28; nkuasrfp1aTg; ubs3Tg; uq11bhTg standard conditions Fig. 7. with image from Lee et al., 2021
blood circulation decreased process quality, exacerbated radil2asa20161/sa20161; rasip1ubs28/ubs28; nkuasrfp1aTg; ubs3Tg; uq11bhTg standard conditions Fig. 7. with image from Lee et al., 2021
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal radil2asa20161/sa20161; rasip1ubs28/ubs28; s843Tg standard conditions Fig. 7. with image from Lee et al., 2021
intersegmental vessel cell-cell junction assembly decreased process quality, abnormal rasip1ubs28/ubs28; ncv27Tg standard conditions Fig. 8. with image from Lee et al., 2021
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal rasip1ubs28/ubs28; ncv27Tg standard conditions Fig. 8. with image from Lee et al., 2021
Citations