CRISPR

CRISPR11-wfikkn1

ID
ZDB-CRISPR-221116-4
Name
CRISPR11-wfikkn1
Previous Names
None
Target
Sequence
5' - GGTGGAGGCGTGGGGTCCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3 end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
osu2 wfikkn1
Expression
Gene expression in Wild Types + CRISPR11-wfikkn1
No data available
Phenotype
Phenotype resulting from CRISPR11-wfikkn1
No data available
Phenotype of all Fish created by or utilizing CRISPR11-wfikkn1
Phenotype Fish Conditions Figures
whole organism cyp1a expression increased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism mhc1uba expression decreased amount, abnormal wfikkn1osu2/osu2 standard conditions Fig. 4 from Shankar et al., 2022
whole organism ugt2a5 expression decreased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
social behavior disrupted, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 10 from Shankar et al., 2022
whole organism olig4 expression decreased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism mhc1uba expression decreased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism cyp1c2 expression increased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism zp2l2 expression decreased amount, abnormal wfikkn1osu2/osu2 standard conditions Fig. 4 from Shankar et al., 2022
whole organism ahrra expression increased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism areg expression decreased amount, abnormal wfikkn1osu2/osu2 standard conditions Fig. 4 from Shankar et al., 2022
whole organism ifit8 expression increased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism rims3 expression decreased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism areg expression decreased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism fsd1l expression decreased amount, abnormal wfikkn1osu2/osu2 standard conditions Fig. 4 from Shankar et al., 2022
whole organism mhc1zka expression increased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism ifit8 expression increased amount, abnormal wfikkn1osu2/osu2 standard conditions Fig. 4 from Shankar et al., 2022
social behavior disrupted, abnormal wfikkn1osu2/osu2 standard conditions Fig. 10 from Shankar et al., 2022
whole organism slc6a17 expression increased amount, abnormal wfikkn1osu2/osu2 standard conditions Fig. 4 from Shankar et al., 2022
whole organism hmcn2 expression decreased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism olig4 expression decreased amount, abnormal wfikkn1osu2/osu2 standard conditions Fig. 4 from Shankar et al., 2022
whole organism phf5a expression increased amount, abnormal wfikkn1osu2/osu2 standard conditions Fig. 4 from Shankar et al., 2022
whole organism znf1094 expression increased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism slc6a17 expression decreased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
locomotion occurrence, ameliorated wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 10 from Shankar et al., 2022
whole organism cyp1c1 expression increased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
locomotion decreased occurrence, abnormal wfikkn1osu2/osu2 standard conditions Fig. 10 from Shankar et al., 2022
whole organism nr6a1a expression decreased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism phf5a expression increased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism tia1 expression decreased amount, abnormal wfikkn1osu2/osu2 chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 4 from Shankar et al., 2022
whole organism pimr134 expression increased amount, abnormal wfikkn1osu2/osu2 standard conditions Fig. 4 from Shankar et al., 2022
Citations