CRISPR

CRISPR7-nr3c2

ID
ZDB-CRISPR-221101-3
Name
CRISPR7-nr3c2
Previous Names
None
Target
Sequence
5' - GAGGCGTCAGGATGCCACTA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ia32 nr3c2
Expression
Gene expression in Wild Types + CRISPR7-nr3c2
No data available
Phenotype
Phenotype resulting from CRISPR7-nr3c2
No data available
Phenotype of all Fish created by or utilizing CRISPR7-nr3c2
Phenotype Fish Conditions Figures
whole organism pnpla3 expression decreased amount, abnormal nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 5 with image from Dinarello et al., 2022
whole organism epas1a expression decreased amount, abnormal nr3c2ia32/ia32 standard conditions Figure 2 with image from Dinarello et al., 2022
whole organism slc25a25a expression amount, ameliorated nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 3 with image from Dinarello et al., 2022
whole organism ucp2 expression amount, ameliorated nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 2 with image from Dinarello et al., 2022
whole organism ddit4 expression increased amount, abnormal nr3c2ia32/ia32 standard conditions Figure 5 with image from Dinarello et al., 2022
whole organism ucp3 expression decreased amount, abnormal nr3c2ia32/ia32 standard conditions Figure 3 with image from Dinarello et al., 2022
whole organism socs3a expression increased amount, abnormal nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 5 with image from Dinarello et al., 2022
whole organism klf9 expression decreased amount, abnormal nr3c2ia32/ia32 standard conditions Figure 2 with image from Dinarello et al., 2022
whole organism nr3c2 expression decreased amount, abnormal nr3c2ia32/ia32 standard conditions Figure 2 with image from Dinarello et al., 2022
whole organism nr3c1 expression increased amount, abnormal nr3c2ia32/ia32 standard conditions Figure 2 with image from Dinarello et al., 2022
whole organism klf9 expression amount, ameliorated nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 2 with image from Dinarello et al., 2022
whole organism pnpla3 expression decreased amount, abnormal nr3c2ia32/ia32 standard conditions Figure 5 with image from Dinarello et al., 2022
whole organism ulk2 expression amount, ameliorated nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 5 with image from Dinarello et al., 2022
whole organism ddit4 expression increased amount, abnormal nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 5 with image from Dinarello et al., 2022
whole organism ucp3 expression amount, ameliorated nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 3 with image from Dinarello et al., 2022
whole organism hif1al expression increased amount, abnormal nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 5 with image from Dinarello et al., 2022
whole organism epas1a expression amount, ameliorated nr3c2ia32/ia32 chemical treatment by environment: dexamethasone Figure 2 with image from Dinarello et al., 2022
whole organism ucp2 expression decreased amount, abnormal nr3c2ia32/ia32 standard conditions Figure 2 with image from Dinarello et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.