CRISPR

CRISPR1-gp9

ID

ZDB-CRISPR-221010-2

Name

CRISPR1-gp9

Previous Names

None

Target

gp9 (1)

Sequence

5' - GGGCAAAGTCACGCACCTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 23

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sm17	gp9

Expression

Gene expression in Wild Types + CRISPR1-gp9

No data available

Phenotype

Phenotype resulting from CRISPR1-gp9

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gp9

Phenotype	Fish	Conditions	Figures
caudal hematopoietic tissue cell population proliferation decreased process quality, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 5 from Lin et al., 2021
thromboblast cell population proliferation decreased process quality, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 5 from Lin et al., 2021
whole organism zfpm1 expression decreased amount, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 4 from Lin et al., 2021
blood thromboblast increased amount, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 4 from Lin et al., 2021
head kidney thromboblast increased amount, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 2 from Lin et al., 2021
caudal fin blood coagulation decreased process quality, abnormal	gp9^sm17/sm17; la2Tg	transection: caudal fin	Fig. 3 from Lin et al., 2021
caudal hematopoietic tissue thrombocyte amount, ameliorated	gp9^sm17/sm17; la2Tg	chemical treatment by environment: 5-aza-2'-deoxycytidine	Fig. 7 from Lin et al., 2021
head kidney hematopoietic stem cell increased amount, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 2 from Lin et al., 2021
whole organism itga2b expression decreased amount, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 4 from Lin et al., 2021
caudal fin accumulation blood, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 3 from Lin et al., 2021
caudal hematopoietic tissue blood coagulation decreased process quality, abnormal	gp9^sm17/sm17; la2Tg	chemical treatment by environment: iron trichloride	Fig. 3 from Lin et al., 2021
blood thrombocyte decreased amount, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 2, Fig. 4 from Lin et al., 2021
head kidney hematopoietic multipotent progenitor cell increased amount, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 2 from Lin et al., 2021
gill blood coagulation decreased process quality, abnormal	gp9^sm17/sm17; la2Tg	chemical treatment by environment: sodium hydroxide	Fig. 3 from Lin et al., 2021
caudal hematopoietic tissue thrombocyte amount, ameliorated	gp9^sm17/sm17; la2Tg	chemical treatment by environment: thrombopoietin receptor agonist	Fig. 7 from Lin et al., 2021
whole organism nfe2 expression decreased amount, abnormal	gp9^sm17/sm17; la2Tg	standard conditions	Fig. 4 from Lin et al., 2021
caudal hematopoietic tissue thrombocyte decreased amount, abnormal	gp9^sm17/sm17; la2Tg	control	Fig. 4, Fig. 6, Fig. 7 from Lin et al., 2021

Citations

Include unpublished citations

Lin, Q., Zhou, R., Meng, P., Wu, L., Yang, L., Liu, W., Wu, J., Cheng, Y., Shi, L., Zhang, Y. (2021) Establishment of a Bernard-Soulier syndrome model in zebrafish. Haematologica. 107(7):1655-1668

1 - 1 of 1

Show