CRISPR

CRISPR1-tpo

ID

ZDB-CRISPR-220919-1

Name

CRISPR1-tpo

Previous Names

None

Target

tpo (1)

Sequence

5' - GGGGTCCGCCAACACCGGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3605	tpo

Expression

Gene expression in Wild Types + CRISPR1-tpo

No data available

Phenotype

Phenotype resulting from CRISPR1-tpo

No data available

Phenotype of all Fish created by or utilizing CRISPR1-tpo

Phenotype	Fish	Conditions	Figures
whole organism weight, ameliorated	tpo^{zf3605/zf3605} (TU)	chemical treatment by environment: L-thyroxine	Fig. 4 from Fang et al., 2022
endocrine system has extra parts of type thyroid follicle, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2 from Fang et al., 2022
pericardial cavity erythematous, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2 from Fang et al., 2022
melanophore stripe has number of melanocyte, ameliorated	tpo^{zf3605/zf3605} (TU)	chemical treatment by environment: L-thyroxine	Fig. 4 from Fang et al., 2022
whole organism pax4 expression decreased amount, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 5 from Fang et al., 2022
thyroid follicle tg expression increased amount, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2 from Fang et al., 2022
thyroid follicle tg expression increased distribution, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2 from Fang et al., 2022
melanophore stripe has extra parts of type melanocyte, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 3, Fig. 4 from Fang et al., 2022
whole organism glucose increased amount, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 5 from Fang et al., 2022
whole organism tshba expression increased amount, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2 from Fang et al., 2022
scale decreased width, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 3 from Fang et al., 2022
whole organism ins expression decreased amount, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 5 from Fang et al., 2022
anterior chamber swim bladder uninflated, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 3 from Fang et al., 2022
whole organism gcga expression increased amount, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 5 from Fang et al., 2022
whole organism decreased length, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2, Fig. 4 from Fang et al., 2022
thyroid follicle Ab1-thyroxine labeling absent, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2 from Fang et al., 2022
whole organism decreased weight, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 4 from Fang et al., 2022
neurocranium decreased height, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 3 from Fang et al., 2022
whole organism tg expression increased amount, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2 from Fang et al., 2022
hypophysis tshba expression increased distribution, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2 from Fang et al., 2022
whole organism glucose homeostasis process quality, ameliorated	tpo^{zf3605/zf3605} (TU)	chemical treatment by environment: L-thyroxine	Fig. 5 from Fang et al., 2022
whole organism glucose amount, ameliorated	tpo^{zf3605/zf3605} (TU)	chemical treatment by environment: L-thyroxine	Fig. 5 from Fang et al., 2022
whole organism glucose homeostasis decreased process quality, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 5 from Fang et al., 2022
hypophysis tshba expression increased amount, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 2 from Fang et al., 2022
whole organism mnx1 expression decreased amount, abnormal	tpo^{zf3605/zf3605} (TU)	standard conditions	Fig. 5 from Fang et al., 2022
whole organism length, ameliorated	tpo^{zf3605/zf3605} (TU)	chemical treatment by environment: L-thyroxine	Fig. 4 from Fang et al., 2022

Citations