CRISPR

CRISPR7-duox

ID
ZDB-CRISPR-220526-1
Name
CRISPR7-duox
Previous Names
None
Target
Sequence
5' - GGACTGACTCTTGCGCCCCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR7-duox
No data available
Phenotype
Phenotype resulting from CRISPR7-duox
No data available
Phenotype of all Fish created by or utilizing CRISPR7-duox
No data available
Citations