CRISPR

CRISPR2-sgsh

ID

ZDB-CRISPR-220325-2

Name

CRISPR2-sgsh

Previous Names

None

Target

sgsh (1)

Sequence

5' - CCAGGCCTACGTCAGTCTAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mnu301	sgsh

Expression

Gene expression in Wild Types + CRISPR2-sgsh

No data available

Phenotype

Phenotype resulting from CRISPR2-sgsh

No data available

Phenotype of all Fish created by or utilizing CRISPR2-sgsh

Phenotype	Fish	Conditions	Figures
whole organism heparan sulfate increased amount, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 1 from Douek et al., 2021
whole organism thigmotaxis decreased process quality, abnormal	sgsh^{mnu301/mnu301} (TU)	control	Figure 2 , Figure 5 from Douek et al., 2021
whole organism locomotory behavior decreased process quality, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 2 from Douek et al., 2021
brain microglial cell ab2-lcp1 labeling spatial pattern, ameliorated	sgsh^{mnu301/mnu301} (TU)	chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor	Figure 5 from Douek et al., 2021
whole organism thigmotaxis increased process quality, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 2 from Douek et al., 2021
brain heparan sulfate increased amount, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 1 from Douek et al., 2021
microglial cell microglial cell activation process quality, ameliorated	sgsh^{mnu301/mnu301} (TU)	chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor	Figure 5 from Douek et al., 2021
cerebellum autophagosome increased amount, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 3 from Douek et al., 2021
brain heparan sulfate proteoglycan catabolic process disrupted, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 1 from Douek et al., 2021
dorsal telencephalon autophagosome increased amount, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 3 from Douek et al., 2021
brain neuroinflammatory response increased process quality, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 4 from Douek et al., 2021
cerebellum lysosome increased amount, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 3 from Douek et al., 2021
whole organism locomotory behavior increased process quality, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 2 from Douek et al., 2021
brain microglial cell active, abnormal	sgsh^{mnu301/mnu301} (TU)	control	Figure 4 , Figure 5 from Douek et al., 2021
midbrain microglial cell active, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 4 from Douek et al., 2021
microglial cell microglial cell activation increased process quality, abnormal	sgsh^{mnu301/mnu301} (TU)	control	Figure 4 , Figure 5 from Douek et al., 2021
brain microglial cell morphology, ameliorated	sgsh^{mnu301/mnu301} (TU)	chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor	Figure 5 from Douek et al., 2021
whole organism increased behavioural activity, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 2 from Douek et al., 2021
whole organism thigmotaxis process quality, ameliorated	sgsh^{mnu301/mnu301} (TU)	chemical treatment by environment: EC 3.4.22.36 (caspase-1) inhibitor	Figure 5 from Douek et al., 2021
whole organism heparan sulfate proteoglycan catabolic process disrupted, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 1 from Douek et al., 2021
microglial cell vacuole increased amount, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 4 from Douek et al., 2021
midbrain neuroinflammatory response increased process quality, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 4 from Douek et al., 2021
midbrain microglial cell ab2-lcp1 labeling increased distribution, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 4 from Douek et al., 2021
brain microglial cell ab2-lcp1 labeling increased distribution, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 4 , Figure 5 from Douek et al., 2021
dorsal telencephalon lysosome increased amount, abnormal	sgsh^{mnu301/mnu301} (TU)	standard conditions	Figure 3 from Douek et al., 2021
whole organism heparan sulfate proteoglycan catabolic process decreased process quality, abnormal	sgsh^mnu301/+ (TU)	standard conditions	Figure 1 from Douek et al., 2021
brain heparan sulfate proteoglycan catabolic process decreased process quality, abnormal	sgsh^mnu301/+ (TU)	standard conditions	Figure 1 from Douek et al., 2021
brain Venus expression increased distribution, abnormal	sgsh^{mnu301/mnu301}; mq8Tg (TU)	standard conditions	Figure 3 from Douek et al., 2021
brain apoptotic process increased process quality, abnormal	sgsh^{mnu301/mnu301}; mq8Tg (TU)	standard conditions	Figure 3 from Douek et al., 2021

Citations