CRISPR

CRISPR1-nckap1l,cdk4

ID

ZDB-CRISPR-220324-3

Previous Names

None

Targets

cdk4 (1)
nckap1l (1)

Sequence

5' - CTCCGCCAGTTTCAGCTGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
lri35	nckap1l
lri90	nckap1l

Expression

Gene expression in Wild Types + CRISPR1-nckap1l,cdk4

No data available

Phenotype

Phenotype resulting from CRISPR1-nckap1l,cdk4

No data available

Phenotype of all Fish created by or utilizing CRISPR1-nckap1l,cdk4

Phenotype	Fish	Conditions	Figures
bile canaliculus cell-cell contact zone altered number of intrahepatic bile duct apical plasma membrane, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 1 from Ghaffari et al., 2021
intrahepatic bile duct EGFP expression spatial pattern, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 1 from Ghaffari et al., 2021
intrahepatic bile duct epithelial cell Ab2-nckap1l labeling decreased amount, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 3 from Ghaffari et al., 2021
intrahepatic bile duct epithelial cell Ab1-brk1 labeling decreased amount, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 3 from Ghaffari et al., 2021
intrahepatic bile duct epithelial cell Ab3-abi1 labeling decreased amount, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 3 from Ghaffari et al., 2021
intrahepatic bile duct epithelial cell Ab1-wasf1 labeling decreased amount, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 3 from Ghaffari et al., 2021
endothelial cell Ab2-nckap1l labeling decreased amount, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 3 from Ghaffari et al., 2021
liver Ab1-brk1 labeling decreased amount, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 3 from Ghaffari et al., 2021
intrahepatic bile duct regulation of morphogenesis of a branching structure decreased spatial extent of a process, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 1 from Ghaffari et al., 2021
intrahepatic bile duct increased thickness, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 1 from Ghaffari et al., 2021
bile canaliculus ab1-abcb11 labeling spatial pattern, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 1 from Ghaffari et al., 2021
intrahepatic bile duct regulation of morphogenesis of a branching structure decreased process quality, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 1 from Ghaffari et al., 2021
intrahepatic bile duct epithelial cell actin cytoskeleton disorganized, abnormal	nckap1l^lri35/lri35; um14Tg	standard conditions	Fig 3 from Ghaffari et al., 2021
intrahepatic bile duct regulation of morphogenesis of a branching structure decreased process quality, abnormal	nckap1l^lri90/+; um14Tg	chemical treatment by environment: NSC 23766 trihydrochloride	Fig 6 from Ghaffari et al., 2021
intrahepatic bile duct regulation of morphogenesis of a branching structure decreased process quality, abnormal	nckap1l^lri90/+; ki109Tg/ki109Tg	standard conditions	Fig 5 from Ghaffari et al., 2021
intrahepatic bile duct regulation of morphogenesis of a branching structure decreased process quality, abnormal	nckap1l^lri90/+; ki109Tg/ki109Tg; um14Tg	standard conditions	Fig 5 from Ghaffari et al., 2021

Citations