CRISPR

CRISPR1-grna

ID

ZDB-CRISPR-220308-2

Name

CRISPR1-grna

Previous Names

None

Target

grna (1)

Sequence

5' - AGAAATGTGACGTAGCTGCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

View all 3 target locations

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3533	grna

Expression

Gene expression in Wild Types + CRISPR1-grna

No data available

Phenotype

Phenotype resulting from CRISPR1-grna

No data available

Phenotype of all Fish created by or utilizing CRISPR1-grna

Phenotype	Fish	Conditions	Figures
long double cone cell decreased amount, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 5 from Zhu et al., 2021
whole organism swimming behavior decreased process quality, abnormal	grna^{zf3533/zf3533} (TU)	control	Fig. 6 from Zhu et al., 2021
whole organism decreased life span, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 2 from Zhu et al., 2021
whole organism decreased weight, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 2 from Zhu et al., 2021
whole organism grna expression decreased amount, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 1 from Zhu et al., 2021
retinal inner nuclear layer increased thickness, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 5 from Zhu et al., 2021
whole organism decreased length, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 2 from Zhu et al., 2021
whole organism swimming behavior increased process quality, abnormal	grna^{zf3533/zf3533} (TU)	chemical treatment by environment: pentetrazol	Fig. 6 from Zhu et al., 2021
retinal outer nuclear layer decreased thickness, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 5 from Zhu et al., 2021
spinal accessory motor neuron axon decreased length, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 3 from Zhu et al., 2021
whole organism viability, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 2 from Zhu et al., 2021
whole organism grna expression increased amount, abnormal	grna^{zf3533/zf3533} (TU)	standard conditions	Fig. 3 from Zhu et al., 2021
whole organism swimming behavior increased process quality, abnormal	grna^zf3533/+ (TU)	chemical treatment by environment: pentetrazol	Fig. 6 from Zhu et al., 2021
whole organism swimming behavior decreased process quality, abnormal	grna^zf3533/+ (TU)	control	Fig. 6 from Zhu et al., 2021
neuromast hair cell decreased amount, abnormal	grna^zf3533/+; sqet4Et (TU)	standard conditions	Fig. 4 from Zhu et al., 2021
whole organism swimming behavior increased process quality, abnormal	grna^{zf3533/zf3533}; zf3534Tg (TU)	chemical treatment by environment: pentetrazol	Fig. 6 from Zhu et al., 2021
spinal accessory motor neuron axon length, ameliorated	grna^{zf3533/zf3533}; zf3534Tg (TU)	standard conditions	Fig. 3 from Zhu et al., 2021
whole organism grna expression decreased amount, abnormal	grna^{zf3533/zf3533}; zf3534Tg (TU)	standard conditions	Fig. 3 from Zhu et al., 2021
whole organism swimming behavior process quality, ameliorated	grna^{zf3533/zf3533}; zf3534Tg (TU)	control	Fig. 6 from Zhu et al., 2021

Citations