CRISPR

CRISPR4-wnt16

ID
ZDB-CRISPR-220217-3
Name
CRISPR4-wnt16
Previous Names
None
Target
Sequence
5' - GGCCTCCTCACCACGGGTCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3561 wnt16
Expression
Gene expression in Wild Types + CRISPR4-wnt16
No data available
Phenotype
Phenotype resulting from CRISPR4-wnt16
No data available
Phenotype of all Fish created by or utilizing CRISPR4-wnt16
Phenotype Fish Conditions Figures
vertebral column curved, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 3 with image from Qu et al., 2021
whole organism wnt16 expression decreased amount, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 2 with image from Qu et al., 2021
vertebral column increased curvature, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 3 with image from Qu et al., 2021
whole organism pla2g4f.2 expression decreased amount, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 6 with image from Qu et al., 2021
whole organism twsg1b expression decreased amount, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 6 with image from Qu et al., 2021
whole organism prkab1a expression decreased amount, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 6 with image from Qu et al., 2021
caudal fin absence of anatomical entity, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 3 with image from Qu et al., 2021
mandibular arch skeleton protruding, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 3 with image from Qu et al., 2021
head bone element decreased amount, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 3 with image from Qu et al., 2021
mandibular arch skeleton deformed, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 3 with image from Qu et al., 2021
bone tissue decreased mass density, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 3 with image from Qu et al., 2021
whole organism bnip4 expression decreased amount, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 6 with image from Qu et al., 2021
whole organism ptena expression decreased amount, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 6 with image from Qu et al., 2021
whole organism vegfaa expression decreased amount, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 6 with image from Qu et al., 2021
vertebral column kinked, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 3 with image from Qu et al., 2021
mandibular arch skeleton increased length, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 3 with image from Qu et al., 2021
whole organism akt1 expression decreased amount, abnormal wnt16zf3561/zf3561 (AB) standard conditions Figure 6 with image from Qu et al., 2021
Citations