CRISPR

CRISPR7-tnnt2a

ID

ZDB-CRISPR-220207-1

Name

CRISPR7-tnnt2a

Previous Names

None

Target

tnnt2a (1)

Sequence

5' - GGTCCTTCTCCATGCGCTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "CGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hu11260	tnnt2a
hu11320	tnnt2a

Expression

Gene expression in Wild Types + CRISPR7-tnnt2a

No data available

Phenotype

Phenotype resulting from CRISPR7-tnnt2a

No data available

Phenotype of all Fish created by or utilizing CRISPR7-tnnt2a

Phenotype	Fish	Conditions	Figures
heart contraction absent process, abnormal	tnnt2a^{hu11260/hu11260} (TL)	standard conditions	text only from Kamel et al., 2021
heart looping disrupted, abnormal	tnnt2a^{hu11320/hu11320} (TL)	standard conditions	text only from Kamel et al., 2021
heart contraction decreased rate, abnormal	tnnt2a^{hu11320/hu11320} (TL)	standard conditions	text only from Kamel et al., 2021
pericardium edematous, abnormal	tnnt2a^{hu11320/hu11320} (TL)	standard conditions	text only from Kamel et al., 2021
whole organism dead, abnormal	tnnt2a^{hu11320/hu11320} (TL)	standard conditions	Figure 1 from Kamel et al., 2021
swimming behavior process quality, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	text only from Kamel et al., 2021
atrium hyperplastic, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 2 from Kamel et al., 2021
heart protruding, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 1 from Kamel et al., 2021
whole organism decreased length, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 1 from Kamel et al., 2021
heart increased size, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 1 from Kamel et al., 2021
female organism oocyte development decreased process quality, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	text only from Kamel et al., 2021
atrium lateral margin col6a1 expression increased distribution, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 3 from Kamel et al., 2021
heart contraction decreased rate, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 4 from Kamel et al., 2021
atrium Collagen increased amount, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 3 from Kamel et al., 2021
atrium Fibrin increased distribution, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 3 from Kamel et al., 2021
whole organism decreased life span, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 1 from Kamel et al., 2021
heart morphology, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 1 from Kamel et al., 2021
atrium increased size, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 2 from Kamel et al., 2021
atrium nppb expression increased amount, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 3 from Kamel et al., 2021
atrium myocardium increased thickness, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 2 from Kamel et al., 2021
cardiac ventricle lateral margin postnb expression increased distribution, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 3 from Kamel et al., 2021
atrium nppb expression increased distribution, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 3 from Kamel et al., 2021
cardiac ventricle decreased size, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 2 from Kamel et al., 2021
cardiac ventricle lateral margin col6a1 expression increased distribution, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 3 from Kamel et al., 2021
atrium Fibrin increased amount, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 3 from Kamel et al., 2021
atrium lateral margin postnb expression increased distribution, abnormal	tnnt2a^hu11320/+ (TL)	standard conditions	Figure 3 from Kamel et al., 2021
heart intracellular calcium ion homeostasis process quality, abnormal	tnnt2a^hu11320/+; ccu1Tg; hu6531Tg (TL)	standard conditions	Figure 5 from Kamel et al., 2021

Citations