CRISPR

CRISPR1-pax3a

ID
ZDB-CRISPR-220203-1
Name
CRISPR1-pax3a
Previous Names
None
Target
Sequence
5' - GGTAGTTTTGGGGTGGCGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
umu5 pax3a
Expression
Gene expression in Wild Types + CRISPR1-pax3a
No data available
Phenotype
Phenotype resulting from CRISPR1-pax3a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-pax3a
Phenotype Fish Conditions Figures
integument pigmentation decreased process quality, abnormal pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
integument pigmentation decreased process quality, abnormal pax3bumu6/umu6; pax3aumu5/umu5 standard conditions Fig. 1 with image from Nord et al., 2021
whole organism pax7b expression increased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5 standard conditions Fig. 7 with image from Nord et al., 2021
primitive pectoral fin abductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax3aumu5/umu5 standard conditions Fig. 3 with image from Nord et al., 2021
primitive pectoral fin adductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax3aumu5/umu5 standard conditions Fig. 3 with image from Nord et al., 2021
whole organism pax7a expression increased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5 standard conditions Fig. 7 with image from Nord et al., 2021
integument pigmentation decreased process quality, abnormal pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor met expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor met expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature decreased functionality, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2021
trunk curved ventral, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 3 with image from Nord et al., 2021
primitive pectoral fin adductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 3 with image from Nord et al., 2021
whole organism lethal (sensu genetics), abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin abductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
sternohyoid myog expression decreased amount, abnormal pax3bumu6/umu6; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature cell population proliferation increased occurrence, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 4 with image from Nord et al., 2021
integument pigmentation decreased process quality, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin adductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 5 with image from Nord et al., 2021
posterior hypaxial muscle myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 5 with image from Nord et al., 2021
sternohyoid myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin abductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature decreased functionality, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 2 with image from Nord et al., 2021
primitive pectoral fin abductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor met expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 3 with image from Nord et al., 2021
primitive pectoral fin abductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 3 with imageFig. 4 with image from Nord et al., 2021
primitive pectoral fin abductor met expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 5 with image from Nord et al., 2021
sternohyoid has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5 standard conditions Fig. 4 with image from Nord et al., 2021
primitive pectoral fin abductor met expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor lbx1a expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor met expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature decreased functionality, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2021
trunk curved ventral, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
whole organism lethal (sensu genetics), abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor lbx1a expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin abductor myog expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor myog expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
sternohyoid myog expression decreased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
myotome EGFP expression increased amount, abnormal pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4; i150Tg perforation: somite 10 Fig. 8 with image from Nord et al., 2021
primitive pectoral fin abductor met expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor met expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature decreased functionality, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2021
primitive pectoral fin abductor lacks all parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 3 with image from Nord et al., 2021
primitive pectoral fin adductor has fewer parts of type skeletal muscle cell, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 3 with image from Nord et al., 2021
whole organism lethal (sensu genetics), abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
trunk curved ventral, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 1 with image from Nord et al., 2021
primitive pectoral fin abductor lbx1a expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
pectoral fin musculature paralysed, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 2 with image from Nord et al., 2021
primitive pectoral fin abductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
primitive pectoral fin adductor myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
posterior hypaxial muscle myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
sternohyoid myog expression decreased amount, abnormal pax3bumu6/umu6; pax7aumu3/umu3; pax3aumu5/umu5; pax7bumu4/umu4 standard conditions Fig. 5 with image from Nord et al., 2021
Citations