CRISPR

CRISPR1-npc2.1

ID
ZDB-CRISPR-220125-6
Name
CRISPR1-npc2.1
Previous Names
None
Target
Sequence
5' - GGACTACAGAGTGCTCGGCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
y536 npc2.1
y537 npc2.1
Expression
Gene expression in Wild Types + CRISPR1-npc2.1
No data available
Phenotype
Phenotype resulting from CRISPR1-npc2.1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-npc2.1
Phenotype Fish Conditions Figures
otolith absent, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image,  Fig. 6 with image from Tseng et al., 2021
whole organism decreased length, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 4 with image from Tseng et al., 2021
head decreased size, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image,  Fig. 6 with image from Tseng et al., 2021
otic vesicle cytoplasm decreased volume, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. S7 from Tseng et al., 2021
post-vent region kinked, ameliorated npc2.1y536/y536 (EKW) chemical treatment: beta-cyclodextrin Fig. 6 with image from Tseng et al., 2021
post-vent region curvature, ameliorated npc2.1y536/y536 (EKW) chemical treatment: beta-cyclodextrin Fig. 6 with image from Tseng et al., 2021
blood circulation disrupted, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image,  Fig. 6 with image from Tseng et al., 2021
trunk cholesterol increased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 3 with image from Tseng et al., 2021
brain decreased size, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image,  Fig. 6 with image from Tseng et al., 2021
trunk dorsal margin msx3 expression decreased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 10 with image from Tseng et al., 2021
brain size, ameliorated npc2.1y536/y536 (EKW) chemical treatment: beta-cyclodextrin Fig. 6 with image from Tseng et al., 2021
post-vent region curved ventral, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image,  Fig. 6 with image from Tseng et al., 2021
yolk syncytial layer cholesterol increased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image from Tseng et al., 2021
otic vesicle notch3 expression decreased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 10 with image from Tseng et al., 2021
neuromast lysosome increased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 3 with image from Tseng et al., 2021
Rohon-Beard neuron axon decreased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. S8 from Tseng et al., 2021
vertebral column increased curvature, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 4 with image,  Fig. S5 from Tseng et al., 2021
peripheral olfactory organ lysosome increased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 3 with image from Tseng et al., 2021
brain notch3 expression decreased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 10 with image from Tseng et al., 2021
hindbrain multivesicular body increased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. S7 from Tseng et al., 2021
hindbrain decreased size, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image from Tseng et al., 2021
vertebral column kinked, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 4 with image,  Fig. S5 from Tseng et al., 2021
brain msx3 expression decreased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 10 with image from Tseng et al., 2021
post-vent region curved lateral, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image,  Fig. 6 with image from Tseng et al., 2021
blood circulation disrupted, ameliorated npc2.1y536/y536 (EKW) chemical treatment: beta-cyclodextrin Fig. 6 with image from Tseng et al., 2021
post-vent region kinked, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image,  Fig. 6 with image from Tseng et al., 2021
central nervous system nkx2.2a expression decreased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. S8 from Tseng et al., 2021
otic vesicle disorganized, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image from Tseng et al., 2021
swim bladder uninflated, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 4 with image from Tseng et al., 2021
otic vesicle msx3 expression decreased amount, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 10 with image from Tseng et al., 2021
head size, ameliorated npc2.1y536/y536 (EKW) chemical treatment: beta-cyclodextrin Fig. 6 with image from Tseng et al., 2021
post-vent region curved dorsal, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 4 with image from Tseng et al., 2021
post-vent region curved dorsal, abnormal npc2.1y536/y536 (EKW) standard conditions Fig. 5 with image,  Fig. 6 with image from Tseng et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.