CRISPR

CRISPR2-lars1b

ID
ZDB-CRISPR-220113-1
Name
CRISPR2-lars1b
Previous Names
None
Target
Sequence
5' - CAGTGTGCCGTCAGATGCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
oi3 lars1b
Expression
Gene expression in Wild Types + CRISPR2-lars1b
No data available
Phenotype
Phenotype resulting from CRISPR2-lars1b
No data available
Phenotype of all Fish created by or utilizing CRISPR2-lars1b
Phenotype Fish Conditions Figures
whole organism ab4-sqstm1 labeling decreased amount, abnormal lars1boi3/oi3 (AB) standard conditions Figure 3 with image from Inoue et al., 2021
liver nucleus fragmented, abnormal lars1boi3/oi3 (AB) standard conditions Figure 3 with image from Inoue et al., 2021
pericardium edematous, abnormal lars1boi3/oi3 (AB) standard conditions Figure 2 with image,  Figure 5 with image from Inoue et al., 2021
swim bladder uninflated, abnormal lars1boi3/oi3 (AB) standard conditions Figure 2 with image,  Figure 5 with image from Inoue et al., 2021
whole organism dead, abnormal lars1boi3/oi3 (AB) standard conditions Figure 2 with image,  Figure 5 with image from Inoue et al., 2021
liver autophagic cell death increased process quality, abnormal lars1boi3/oi3 (AB) standard conditions Figure 3 with image from Inoue et al., 2021
head decreased diameter, abnormal lars1boi3/oi3 (AB) standard conditions Fig. S2 from Inoue et al., 2021
whole organism swimming behavior decreased process quality, abnormal lars1boi3/oi3 (AB) standard conditions Fig. S2 from Inoue et al., 2021
whole organism decreased thickness, abnormal lars1boi3/oi3 (AB) standard conditions Figure 2 with image from Inoue et al., 2021
liver decreased size, abnormal lars1boi3/oi3 (AB) standard conditions Figure 3 with image from Inoue et al., 2021
liver vacuole increased amount, abnormal lars1boi3/oi3 (AB) standard conditions Figure 3 with image from Inoue et al., 2021
whole organism ab3-map1lc3b labeling increased amount, abnormal lars1boi3/oi3 (AB) standard conditions Figure 3 with image from Inoue et al., 2021
liver cytosol condensed, abnormal lars1boi3/oi3 (AB) standard conditions Figure 3 with image from Inoue et al., 2021
whole organism viability, ameliorated lars1boi3/oi3 (AB) chemical treatment by environment: bafilomycin A1 Figure 5 with image from Inoue et al., 2021
nucleate erythrocyte decreased amount, abnormal lars1boi3/oi3 (AB) standard conditions Figure 2 with image from Inoue et al., 2021
whole organism Ab1-lars labeling absent, abnormal lars1boi3/oi3 (AB) standard conditions Figure 1 with image from Inoue et al., 2021
liver size, ameliorated lars1boi3/oi3; oi2Tg (AB) chemical treatment by environment: bafilomycin A1 Figure 5 with image from Inoue et al., 2021
liver mCherry expression decreased distribution, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 2 with image from Inoue et al., 2021
liver autolysosome ab3-map1lc3b labeling increased distribution, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 4 with image from Inoue et al., 2021
spinal cord autolysosome ab3-map1lc3b labeling increased distribution, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 4 with image from Inoue et al., 2021
liver nucleus ab3-map1lc3b labeling increased distribution, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 3 with image from Inoue et al., 2021
skeletal muscle autolysosome ab3-map1lc3b labeling increased distribution, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 4 with image from Inoue et al., 2021
spinal cord autophagosome ab3-map1lc3b labeling increased distribution, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 3 with image,  Figure 4 with image from Inoue et al., 2021
liver mCherry expression decreased amount, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 2 with image from Inoue et al., 2021
skeletal muscle autophagosome ab3-map1lc3b labeling increased distribution, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 3 with image,  Figure 4 with image from Inoue et al., 2021
liver decreased size, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 2 with image,  Figure 5 with image from Inoue et al., 2021
liver vacuole ab3-map1lc3b labeling increased distribution, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 3 with image from Inoue et al., 2021
liver autophagosome ab3-map1lc3b labeling increased distribution, abnormal lars1boi3/oi3; oi2Tg (AB) standard conditions Figure 3 with image,  Figure 4 with image from Inoue et al., 2021
swim bladder inflated, ameliorated lars1boi3/oi3 + MO1-atg5 (AB) control Figure 5 with image from Inoue et al., 2021
pericardium morphology, ameliorated lars1boi3/oi3 + MO1-atg5 (AB) control Figure 5 with image from Inoue et al., 2021
liver size, ameliorated lars1boi3/oi3; oi2Tg + MO1-atg5 (AB) control Figure 5 with image from Inoue et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.