CRISPR

CRISPR3-csf1ra,si:zfos-1069f5.1

ID

ZDB-CRISPR-211217-3

Previous Names

None

Targets

csf1ra (1)
si:zfos-1069f5.1 (1)

Sequence

5' - GGATGCTCTCGATGGCTAAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 14

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nku3	csf1ra

Expression

Gene expression in Wild Types + CRISPR3-csf1ra,si:zfos-1069f5.1

No data available

Phenotype

Phenotype resulting from CRISPR3-csf1ra,si:zfos-1069f5.1

No data available

Phenotype of all Fish created by or utilizing CRISPR3-csf1ra,si:zfos-1069f5.1

Phenotype	Fish	Conditions	Figures
whole organism cpa5 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
fin color pattern, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 2 from Meng et al., 2021
whole organism cel.1 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
integument color pattern, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 2 from Meng et al., 2021
whole organism locomotory behavior increased process quality, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 4 from Meng et al., 2021
whole organism slc22a7a expression decreased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
whole organism scarb1 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
integument xanthophore absent, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 2 from Meng et al., 2021
whole organism abcg5 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
whole organism cpb1 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
whole organism cyp7a1 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
integument melanophore stripe spatial pattern, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 2 from Meng et al., 2021
whole organism fabp6 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
hepatocyte lipid droplet increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
whole organism ctrl expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
integument melanophore stripe structurally discontinuous, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 2 from Meng et al., 2021
integument xanthophore decreased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 2 from Meng et al., 2021
whole organism Ab1-csf1r labeling decreased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 2 from Meng et al., 2021
whole organism fabp10a expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
whole organism cpa4 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
whole organism plpp1a expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
whole organism abcb11b expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
whole organism cel.2 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
whole organism apoda.2 expression increased amount, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021
liver hepatocyte disorganized, abnormal	csf1ra^nku3/nku3 (TU)	standard conditions	Fig. 3 from Meng et al., 2021

Citations

Include unpublished citations

Meng, H., Shang, Y., Cheng, Y., Wang, K., Yu, J., Cao, P., Fan, S., Li, Y., Cui, J. (2021) Knockout of zebrafish colony-stimulating factor 1 receptor by CRISPR/Cas9 affects metabolism and locomotion capacity. Biochemical and Biophysical Research Communications. 551:93-99

1 - 1 of 1

Show