CRISPR

CRISPR3-gstp1.2

ID

ZDB-CRISPR-211208-1

Name

CRISPR3-gstp1.2

Previous Names

CRISPR3-gstp1

Target

gstp1.2 (1)

Sequence

5' - GGACAAAGACCAGCAGCTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 14

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
muz301	gstp1.2

Expression

Gene expression in Wild Types + CRISPR3-gstp1.2

No data available

Phenotype

Phenotype resulting from CRISPR3-gstp1.2

No data available

Phenotype of all Fish created by or utilizing CRISPR3-gstp1.2

Phenotype	Fish	Conditions	Figures
whole organism glutathione disulfide decreased amount, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism atf4a expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5 from Zhang et al., 2021
whole organism glutathione normal amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism sod1 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 6 from Zhang et al., 2021
pericardium edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 3 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism baxb expression amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 7 from Zhang et al., 2021
cell redox homeostasis disrupted, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism nfe2l2a expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 6 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism glutathione increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
whole organism xbp1 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5, Fig. 6, Fig. 7 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism gadd45aa expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5 from Zhang et al., 2021
whole organism glutathione disulfide decreased amount, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
cell redox homeostasis disrupted, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism nfe2l2a expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 6 from Zhang et al., 2021
whole organism reactive oxygen species normal amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
pericardium edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 3 from Zhang et al., 2021
whole organism glutathione disulfide decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
pericardium edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 3 from Zhang et al., 2021
whole organism reactive oxygen species decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
whole organism glutathione normal amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
yolk syncytial layer edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 3 from Zhang et al., 2021
whole organism hspa5 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5 from Zhang et al., 2021
caudal fin curved, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 3 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
whole organism glutathione increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
glutathione transferase activity decreased magnitude, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 1 from Zhang et al., 2021
whole organism glutathione disulfide decreased amount, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
whole organism increased sensitivity toward whole organism tunicamycin, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 2 from Zhang et al., 2021
whole organism hspa5 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 7 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism reactive oxygen species increased amount, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
whole organism nfe2l2a expression increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 6 from Zhang et al., 2021
yolk syncytial layer edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 3 from Zhang et al., 2021
whole organism xbp1 expression amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 7 from Zhang et al., 2021
whole organism xbp1 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 6, Fig. 7 from Zhang et al., 2021
whole organism ddit3 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
vertebral column curved, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 3 from Zhang et al., 2021
whole organism ddit3 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 7 from Zhang et al., 2021
whole organism gstp1.2 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 1 from Zhang et al., 2021
whole organism increased sensitivity toward whole organism thapsigargin, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 2 from Zhang et al., 2021
whole organism xbp1 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 6, Fig. 7 from Zhang et al., 2021
whole organism sod1 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 6 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
whole organism reactive oxygen species increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
whole organism increased sensitivity toward whole organism PABA/NO, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 2 from Zhang et al., 2021
whole organism hspa5 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 7 from Zhang et al., 2021
whole organism hspa5 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 7 from Zhang et al., 2021
whole organism viability, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 1 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021

Citations

Include unpublished citations

Zhang, L., Kim, S.H., Park, K.H., Townsend, D., Tew, K.D. (2021) Glutathione S-Transferase P Influences Redox Homeostasis and Response to Drugs that Induce the Unfolded Protein Response in Zebrafish. The Journal of pharmacology and experimental therapeutics. 377(1):121-132

1 - 1 of 1

Show