CRISPR

CRISPR3-gstp1.2

ID

ZDB-CRISPR-211208-1

Name

CRISPR3-gstp1.2

Previous Names

CRISPR3-gstp1

Target

gstp1.2 (1)

Sequence

5' - GGACAAAGACCAGCAGCTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
muz301	gstp1.2

Expression

Gene expression in Wild Types + CRISPR3-gstp1.2

No data available

Phenotype

Phenotype resulting from CRISPR3-gstp1.2

No data available

Phenotype of all Fish created by or utilizing CRISPR3-gstp1.2

Phenotype	Fish	Conditions	Figures
whole organism glutathione disulfide decreased amount, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism atf4a expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5 from Zhang et al., 2021
whole organism glutathione normal amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism sod1 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 6 from Zhang et al., 2021
pericardium edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 3 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism baxb expression amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 7 from Zhang et al., 2021
cell redox homeostasis disrupted, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism nfe2l2a expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 6 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism glutathione increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism xbp1 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5, Fig. 6, Fig. 7 from Zhang et al., 2021
whole organism gadd45aa expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5 from Zhang et al., 2021
whole organism glutathione disulfide decreased amount, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
cell redox homeostasis disrupted, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism nfe2l2a expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 6 from Zhang et al., 2021
whole organism reactive oxygen species normal amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
pericardium edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 3 from Zhang et al., 2021
whole organism glutathione disulfide decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
pericardium edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 3 from Zhang et al., 2021
whole organism reactive oxygen species decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
whole organism glutathione normal amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
yolk syncytial layer edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 3 from Zhang et al., 2021
whole organism hspa5 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5 from Zhang et al., 2021
caudal fin curved, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 3 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
whole organism glutathione increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
glutathione transferase activity decreased magnitude, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 1 from Zhang et al., 2021
whole organism glutathione disulfide decreased amount, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
whole organism increased sensitivity toward whole organism tunicamycin, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 2 from Zhang et al., 2021
whole organism hspa5 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 7 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism reactive oxygen species increased amount, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 4 from Zhang et al., 2021
whole organism gclc expression increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
whole organism nfe2l2a expression increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 6 from Zhang et al., 2021
yolk syncytial layer edematous, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 3 from Zhang et al., 2021
whole organism xbp1 expression amount, ameliorated	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 7 from Zhang et al., 2021
whole organism xbp1 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 6, Fig. 7 from Zhang et al., 2021
whole organism ddit3 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 5 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 4 from Zhang et al., 2021
vertebral column curved, exacerbated	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 3 from Zhang et al., 2021
whole organism ddit3 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 7 from Zhang et al., 2021
whole organism gstp1.2 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 1 from Zhang et al., 2021
whole organism increased sensitivity toward whole organism thapsigargin, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: thapsigargin	Fig. 2 from Zhang et al., 2021
whole organism xbp1 expression decreased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 6, Fig. 7 from Zhang et al., 2021
whole organism sod1 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 6 from Zhang et al., 2021
whole organism gclm expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 4 from Zhang et al., 2021
whole organism reactive oxygen species increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021
whole organism increased sensitivity toward whole organism PABA/NO, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 2 from Zhang et al., 2021
whole organism hspa5 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: tunicamycin	Fig. 7 from Zhang et al., 2021
whole organism hspa5 expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 7 from Zhang et al., 2021
whole organism viability, abnormal	gstp1.2^{muz301/muz301}	standard conditions	Fig. 1 from Zhang et al., 2021
whole organism gsr expression increased amount, abnormal	gstp1.2^{muz301/muz301}	chemical treatment by environment: PABA/NO	Fig. 4 from Zhang et al., 2021

Citations