CRISPR

CRISPR1-rspo3

ID

ZDB-CRISPR-211118-5

Name

CRISPR1-rspo3

Previous Names

None

Target

rspo3 (1)

Sequence

5' - GAGCTCCCAGGGCTGCCAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3495	rspo3

Expression

Gene expression in Wild Types + CRISPR1-rspo3

No data available

Phenotype

Phenotype resulting from CRISPR1-rspo3

No data available

Phenotype of all Fish created by or utilizing CRISPR1-rspo3

Phenotype	Fish	Conditions	Figures
nasal bone increased distance frontal bone, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 7 from Alhazmi et al., 2021
parasphenoid increased angle to frontal bone, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 7 from Alhazmi et al., 2021
ceratobranchial 5 tooth decreased amount, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 8 from Alhazmi et al., 2021
hyomandibula osteoclast active, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 6 from Alhazmi et al., 2021
cranium osteoclast active, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 6 from Alhazmi et al., 2021
Meckel's cartilage decreased length, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 5 from Alhazmi et al., 2021
ceratobranchial 5 tooth osteoclast active, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 6 from Alhazmi et al., 2021
anguloarticular decreased volume, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 7 from Alhazmi et al., 2021
mandibular arch skeleton osteoclast active, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 6 from Alhazmi et al., 2021
nasal bone increased distance dentary, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 7 from Alhazmi et al., 2021
dentary osteoclast active, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 6 from Alhazmi et al., 2021
parasphenoid decreased volume, abnormal	rspo3^{zf3495/zf3495}	standard conditions	Figure 7 from Alhazmi et al., 2021
pectoral fin development decreased process quality, abnormal	rspo3^zf3495/+ + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 4 from Alhazmi et al., 2021
Meckel's cartilage decreased length, abnormal	rspo3^zf3495/+ + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 5 from Alhazmi et al., 2021
pectoral fin decreased amount, abnormal	rspo3^zf3495/+ + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 4 from Alhazmi et al., 2021
ceratobranchial 5 tooth decreased amount, abnormal	rspo3^zf3495/+ + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 5 from Alhazmi et al., 2021
Meckel's cartilage decreased angle to palatoquadrate cartilage, abnormal	rspo3^zf3495/+ + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 4 from Alhazmi et al., 2021
ceratohyal cartilage decreased length, abnormal	rspo3^zf3495/+ + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 5 from Alhazmi et al., 2021
pectoral fin development disrupted, abnormal	rspo3^{zf3495/zf3495} + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 4 from Alhazmi et al., 2021
pectoral fin absent, abnormal	rspo3^{zf3495/zf3495} + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 4 from Alhazmi et al., 2021
Meckel's cartilage decreased length, abnormal	rspo3^{zf3495/zf3495} + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 5 from Alhazmi et al., 2021
ventral mandibular arch morphology, abnormal	rspo3^{zf3495/zf3495} + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 4 from Alhazmi et al., 2021
ceratobranchial 5 tooth absent, abnormal	rspo3^{zf3495/zf3495} + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 5 from Alhazmi et al., 2021
Meckel's cartilage decreased angle to palatoquadrate cartilage, abnormal	rspo3^{zf3495/zf3495} + CRISPR1-rspo2 + CRISPR2-rspo2 + CRISPR3-rspo2 + CRISPR4-rspo2	control	Figure 4 from Alhazmi et al., 2021

Citations