CRISPR

CRISPR4-cdhr1a

ID
ZDB-CRISPR-210928-2
Name
CRISPR4-cdhr1a
Previous Names
None
Target
Sequence
5' - TCTGGCACATCTACGATGGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uky203 cdhr1a
Expression
Gene expression in Wild Types + CRISPR4-cdhr1a
No data available
Phenotype
Phenotype resulting from CRISPR4-cdhr1a
No data available
Phenotype of all Fish created by or utilizing CRISPR4-cdhr1a
Phenotype Fish Conditions Figures
retinal rod cell cell projection increased length, abnormal cdhr1auky203/uky203 standard conditions Figure 7 with image from Patel et al., 2026
retinal rod cell decreased amount, abnormal cdhr1auky203/uky203 standard conditions Figure 6 with image from Patel et al., 2026
retinal cone cell photoreceptor disc membrane disorganized, abnormal cdhr1auky203/uky203 standard conditions Figure 5 with image from Patel et al., 2026
retinal rod cell rod photoreceptor outer segment decreased length, abnormal cdhr1auky203/uky203 standard conditions Figure 6 with image from Patel et al., 2026
retinal cone cell cone photoreceptor outer segment decreased length, abnormal cdhr1auky203/uky203 standard conditions Figure 5 with image from Patel et al., 2026
retinal cone cell cell projection decreased length, abnormal cdhr1auky203/uky203 standard conditions Figure 7 with image from Patel et al., 2026
retinal cone cell decreased amount, abnormal cdhr1auky203/uky203 standard conditions Figure 5 with image from Patel et al., 2026
retinal rod cell cell projection decreased length, abnormal cdhr1auky203/uky203 standard conditions Figure 7 with image from Patel et al., 2026
retinal cone cell cell projection increased length, abnormal cdhr1auky203/uky203 standard conditions Figure 7 with image from Patel et al., 2026
retinal cone cell cone photoreceptor outer segment increased length, abnormal cdhr1auky203/uky203 standard conditions Figure 5 with image,  Figure 9 with image from Patel et al., 2026
photoreceptor cell photoreceptor outer segment cdhr1a expression absent, abnormal cdhr1auky203/uky203 standard conditions Figure 4 with image from Patel et al., 2026
retinal outer nuclear layer cdhr1a expression absent, abnormal AB + CRISPR3-cdhr1a + CRISPR4-cdhr1a standard conditions Fig. 9 from Piedade et al., 2020
retinal rod cell decreased amount, abnormal fl1Tg + CRISPR3-cdhr1a + CRISPR4-cdhr1a standard conditions Fig. 9 from Piedade et al., 2020
retinal cone cell decreased amount, abnormal ucd1Tg + CRISPR3-cdhr1a + CRISPR4-cdhr1a standard conditions Fig. 9 from Piedade et al., 2020
retinal cone cell cone photoreceptor outer segment decreased length, abnormal cdhr1auky203/uky203; pcdh15buky204/+ standard conditions Figure 9 with image from Patel et al., 2026
retinal cone cell cone photoreceptor outer segment decreased length, exacerbated cdhr1auky203/uky203; pcdh15buky204/uky204 standard conditions Figure 9 with image from Patel et al., 2026
Citations