CRISPR

CRISPR1-akr1a1b

ID

ZDB-CRISPR-210907-1

Name

CRISPR1-akr1a1b

Previous Names

None

Target

akr1a1b (1)

Sequence

5' - GGTCCAAGTACTCCAGCTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site is "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uh8	akr1a1b
uh9	akr1a1b

Expression

Gene expression in Wild Types + CRISPR1-akr1a1b

No data available

Phenotype

Phenotype resulting from CRISPR1-akr1a1b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-akr1a1b

Phenotype	Fish	Conditions	Figures
renal glomerulus length, ameliorated	akr1a1b^uh8/uh8; li1Tg	chemical treatment: N(gamma)-nitro-L-arginine methyl ester	Fig. 7 from Li et al., 2020
whole organism aldo-keto reductase (NADPH) activity decreased process quality, abnormal	akr1a1b^uh8/uh8; li1Tg	standard conditions	Fig. 2 from Li et al., 2020
renal glomerulus size, ameliorated	akr1a1b^uh8/uh8; li1Tg	chemical treatment: N(gamma)-nitro-L-arginine methyl ester	Fig. 7 from Li et al., 2020
renal glomerulus increased size, abnormal	akr1a1b^uh8/uh8; li1Tg	control	Fig. 3 , Fig. 7 from Li et al., 2020
renal glomerulus glomerular filtration decreased rate, abnormal	akr1a1b^uh8/uh8; li1Tg	chemical treatment by injection: dextran	Fig. 3 from Li et al., 2020
renal glomerulus increased length, abnormal	akr1a1b^uh8/uh8; li1Tg	control	Fig. 3 , Fig. 7 from Li et al., 2020
whole organism alanine increased amount, abnormal	akr1a1b^uh8/uh8; li1Tg	standard conditions	Fig. 5 from Li et al., 2020
whole organism glutamate(1-) increased amount, abnormal	akr1a1b^uh8/uh8; li1Tg	standard conditions	Fig. 5 from Li et al., 2020
whole organism methylglyoxal increased amount, abnormal	akr1a1b^uh9/+; akr1a1b^uh8/+; li1Tg; y1Tg	standard conditions	Fig. 2 from Li et al., 2020
liver pck1 expression decreased amount, abnormal	akr1a1b^uh9/+; akr1a1b^uh8/+; li1Tg; y1Tg	fasting	Fig. 6 from Li et al., 2020
kidney glutamate(1-) increased amount, abnormal	akr1a1b^uh9/+; akr1a1b^uh8/+; li1Tg; y1Tg	fasting	Fig. 5 from Li et al., 2020
blood glucose decreased amount, abnormal	akr1a1b^uh9/+; akr1a1b^uh8/+; li1Tg; y1Tg	fasting	Fig. 6 from Li et al., 2020
kidney pck1 expression decreased amount, abnormal	akr1a1b^uh9/+; akr1a1b^uh8/+; li1Tg; y1Tg	fasting	Fig. 6 from Li et al., 2020
whole organism nitrotyrosine increased amount, abnormal	akr1a1b^uh9/uh9; y1Tg	standard conditions	Fig. 7 from Li et al., 2020
whole organism pck1 expression amount, ameliorated	akr1a1b^uh9/uh9; y1Tg	chemical treatment: N(gamma)-nitro-L-arginine methyl ester	Fig. 7 from Li et al., 2020
whole organism pck1 expression decreased amount, abnormal	akr1a1b^uh9/uh9; y1Tg	control	Fig. 7 from Li et al., 2020
kidney protein nitrosylation increased process quality, abnormal	akr1a1b^uh9/uh9; y1Tg	standard conditions	Fig. 7 from Li et al., 2020
pronephric proximal convoluted tubule lysosome increased amount, abnormal	akr1a1b^uh9/uh9; y1Tg	standard conditions	Fig. 4 from Li et al., 2020

Citations