CRISPR
CRISPR54-tyr
- ID
- ZDB-CRISPR-210903-6
- Name
- CRISPR54-tyr
- Previous Names
- None
- Target
- Sequence
-
5' - CGTTGGGAAGGTCGGACACC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "AGG" at the 3' end.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR54-tyr
No data available
Phenotype
Phenotype resulting from CRISPR54-tyr
Phenotype | Fish | Figures |
---|---|---|
retina decreased pigmentation, abnormal | AB + CRISPR54-tyr |
Fig. 2 ![]() ![]() |
trunk decreased pigmentation, abnormal | AB + CRISPR54-tyr |
Fig. 2 ![]() ![]() |
1 - 2 of 2
Phenotype of all Fish created by or utilizing CRISPR54-tyr
1 - 4 of 4
Citations
- Huttner, I.G., Santiago, C.F., Jacoby, A., Cheng, D., Trivedi, G., Cull, S., Cvetkovska, J., Chand, R., Berger, J., Currie, P.D., Smith, K.A., Fatkin, D. (2023) Loss of Sec-1 Family Domain-Containing 1 (scfd1) Causes Severe Cardiac Defects and Endoplasmic Reticulum Stress in Zebrafish. Journal of cardiovascular development and disease. 10(10):
- Kroll, F., Powell, G.T., Ghosh, M., Gestri, G., Antinucci, P., Hearn, T.J., Tunbak, H., Lim, S., Dennis, H.W., Fernandez, J.M., Whitmore, D., Dreosti, E., Wilson, S.W., Hoffman, E.J., Rihel, J. (2021) A simple and effective F0 knockout method for rapid screening of behaviour and other complex phenotypes. eLIFE. 10:
- Zhao, D., Jones, J.L., Gasperini, R.J., Charlesworth, J.C., Liu, G.S., Burdon, K.P. (2021) Rapid and efficient cataract gene evaluation in F0 zebrafish using CRISPR-Cas9 ribonucleoprotein complexes. Methods (San Diego, Calif.). 194:37-47
1 - 3 of 3
Show