CRISPR

CRISPR2-nrl

ID
ZDB-CRISPR-210805-2
Name
CRISPR2-nrl
Previous Names
None
Target
Sequence
5' - GGGAGGTCCGTCACTCAGCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ua5009 nrl
ua5014 nrl
Expression
Gene expression in Wild Types + CRISPR2-nrl
No data available
Phenotype
Phenotype resulting from CRISPR2-nrl
No data available
Phenotype of all Fish created by or utilizing CRISPR2-nrl
Phenotype Fish Conditions Figures
retina quality of interaction of a substance with electromagnetic radiation, abnormal nrlua5009/ua5009 standard conditions Figure 6 with image from Oel et al., 2020
short single cone cell ab1-10c9.1 labeling increased amount, abnormal nrlua5009/ua5009 standard conditions Fig. 2 with image from Neil et al., 2024
retinal rod cell decreased amount, abnormal nrlua5009/ua5009 standard conditions Figure 1 with image from Oel et al., 2020
retina nrl expression increased amount, abnormal nrlua5009/ua5009 standard conditions Figure 5 with image from Oel et al., 2020
retina nr2e3 expression decreased amount, abnormal nrlua5009/ua5009 standard conditions Figure 5 with image from Oel et al., 2020
retina increased size, abnormal nrlua5009/ua5009 standard conditions Figure 6 with image from Oel et al., 2020
short single cone cell increased amount, abnormal nrlua5009/ua5009 standard conditions Figure 1 with image from Oel et al., 2020
retinal rod cell ab-4c12 labeling decreased amount, abnormal nrlua5009/ua5009 standard conditions Fig. 2 with image from Neil et al., 2024
Figure 1 with image from Oel et al., 2020
retina synaptic ribbon increased amount, abnormal nrlua5009/ua5009 standard conditions Figure 6 with image from Oel et al., 2020
whole organism tbx2b expression increased amount, abnormal nrlua5009/ua5009 standard conditions Fig. 4 with image from Neil et al., 2024
whole organism rho expression decreased amount, abnormal nrlua5009/ua5009 standard conditions Fig. 4 with image from Neil et al., 2024
retinal rod cell Ab1-Nrl labeling decreased amount, abnormal nrlua5009/ua5009 standard conditions Figure 1 with image from Oel et al., 2020
whole organism nr2e3 expression decreased amount, abnormal nrlua5009/ua5009 standard conditions Fig. 4 with image from Neil et al., 2024
retinal outer nuclear layer nrl expression increased amount, abnormal nrlua5009/ua5009 standard conditions Figure 5 with image from Oel et al., 2020
whole organism nrl expression increased amount, abnormal nrlua5009/ua5009 standard conditions Fig. 4 with image from Neil et al., 2024
retinal rod cell EGFP expression decreased amount, abnormal nrlua5009/ua5009; kj2Tg/kj2Tg standard conditions Figure 4 with image from Oel et al., 2020
whole organism tbx2b expression increased amount, abnormal nrlua5009/ua5009; tbx2bp25bbtl/p25bbtl standard conditions Fig. 4 with image from Neil et al., 2024
whole organism nr2e3 expression decreased amount, abnormal nrlua5009/ua5009; tbx2bp25bbtl/p25bbtl standard conditions Fig. 4 with image from Neil et al., 2024
retinal rod cell synapse absent, abnormal nrlua5009/ua5009; tbx2bp25bbtl/p25bbtl standard conditions Fig. 3 with image from Neil et al., 2024
retinal rod cell ab-4c12 labeling decreased amount, abnormal nrlua5009/ua5009; tbx2bp25bbtl/p25bbtl standard conditions Fig. 2 with image from Neil et al., 2024
whole organism nrl expression increased amount, abnormal nrlua5009/ua5009; tbx2bp25bbtl/p25bbtl standard conditions Fig. 4 with image from Neil et al., 2024
whole organism rho expression decreased amount, abnormal nrlua5009/ua5009; tbx2bp25bbtl/p25bbtl standard conditions Fig. 4 with image from Neil et al., 2024
short single cone cell ab1-10c9.1 labeling increased amount, abnormal nrlua5009/ua5009; tbx2bp25bbtl/p25bbtl standard conditions Fig. 2 with image from Neil et al., 2024
whole organism opn1sw1 expression increased amount, abnormal nrlua5009/ua5009; tbx2bp25bbtl/p25bbtl standard conditions Fig. 4 with image from Neil et al., 2024
retinal cone cell photoreceptor outer segment membrane absent, abnormal nrlua5009/ua5009; tbx2bp25bbtl/p25bbtl standard conditions Fig. 3 with image from Neil et al., 2024
retinal rod cell shape, abnormal nrlua5009/ua5009; ua3162Tg/ua3162Tg standard conditions Figure 2 with image from Oel et al., 2020
Citations