CRISPR

CRISPR1-znf488

ID

ZDB-CRISPR-210607-1

Name

CRISPR1-znf488

Previous Names

CRISPR1-prdm8

Target

znf488 (1)

Sequence

5' - GGAATAAATCCTATGTATTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
co49	znf488
co51	znf488

Expression

Gene expression in Wild Types + CRISPR1-znf488

No data available

Phenotype

Phenotype resulting from CRISPR1-znf488

No data available

Phenotype of all Fish created by or utilizing CRISPR1-znf488

Phenotype	Fish	Conditions	Figures
oligodendrocyte increased amount, abnormal	znf488^co49/co49	standard conditions	Fig. 4 , Fig. 10 from Scott et al., 2020
spinal cord boc expression decreased amount, abnormal	znf488^co49/co49	standard conditions	Fig. 9 from Scott et al., 2020
motor neuron decreased amount, abnormal	znf488^co49/co49	chemical treatment by environment: Cyclopamine	Fig. 10 from Scott et al., 2020
motor neuron decreased amount, abnormal	znf488^co49/co49	control	Fig. 10 from Scott et al., 2020
oligodendrocyte increased amount, abnormal	znf488^co49/co49	chemical treatment by environment: Cyclopamine	Fig. 10 from Scott et al., 2020
oligodendrocyte myrf expression mislocalised, abnormal	znf488^co49/co49	standard conditions	Fig. 4 , Fig. 10 from Scott et al., 2020
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal	znf488^co49/co49	chemical treatment by environment: Cyclopamine	Fig. 10 from Scott et al., 2020
motor neuron normal amount, ameliorated	znf488^co49/co49	chemical treatment by environment: Cyclopamine	Fig. 10 from Scott et al., 2020
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal	znf488^co49/co49	control	Fig. 10 from Scott et al., 2020
spinal cord ptch2 expression increased amount, abnormal	znf488^co49/co49	standard conditions	Fig. 9 from Scott et al., 2020
oligodendrocyte myrf expression mislocalised, abnormal	znf488^co49/co49	chemical treatment by environment: Cyclopamine	Fig. 10 from Scott et al., 2020
oligodendrocyte mbpa expression mislocalised, abnormal	znf488^co49/co49	standard conditions	Fig. 4 from Scott et al., 2020
oligodendrocyte increased amount, abnormal	znf488^co51/co51	standard conditions	Fig. 4 from Scott et al., 2020
oligodendrocyte myrf expression mislocalised, abnormal	znf488^co51/co51	standard conditions	Fig. 4 from Scott et al., 2020
oligodendrocyte increased amount, abnormal	znf488^co49/co49; co25Tg	standard conditions	Fig. 5 from Scott et al., 2020
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal	znf488^co49/co49; co28Tg	standard conditions	Fig. 5 from Scott et al., 2020
motor neuron decreased amount, abnormal	znf488^co49/co49; vu12Tg	standard conditions	Fig. 6 from Scott et al., 2020
motor neuron increased amount, abnormal	znf488^co49/co49; vu12Tg	standard conditions	Fig. 8 from Scott et al., 2020
spinal cord glioblast (sensu Vertebrata) mislocalised dorsally, abnormal	znf488^co49/co49; vu12Tg	standard conditions	Fig. 8 from Scott et al., 2020
oligodendrocyte increased amount, abnormal	znf488^co51/+; znf488^co49/+	standard conditions	Fig. 4 from Scott et al., 2020
oligodendrocyte myrf expression mislocalised, abnormal	znf488^co51/+; znf488^co49/+	standard conditions	Fig. 4 from Scott et al., 2020

Citations