CRISPR

CRISPR4-vwa1

ID
ZDB-CRISPR-210503-4
Name
CRISPR4-vwa1
Previous Names
None
Target
Sequence
5' - GGCACTCGAAGCGGGCCACT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
pkm101 vwa1
Expression
Gene expression in Wild Types + CRISPR4-vwa1
No data available
Phenotype
Phenotype resulting from CRISPR4-vwa1
Phenotype of all Fish created by or utilizing CRISPR4-vwa1
Phenotype Fish Conditions Figures
palatoquadrate cartilage hypoplastic, abnormal vwa1pkm101/pkm101 (TU) control Figure 2 with image from Niu et al., 2023
pharyngeal arch fgfr3 expression decreased distribution, abnormal vwa1pkm101/pkm101 (TU) standard conditions Figure 6 with image from Niu et al., 2023
pharyngeal arch barx1 expression decreased distribution, abnormal vwa1pkm101/pkm101 (TU) standard conditions Figure 4 with image from Niu et al., 2023
ceratobranchial cartilage hypoplastic, abnormal vwa1pkm101/pkm101 (TU) control Figure 2 with image from Niu et al., 2023
pharyngeal arch fgf8a expression decreased distribution, abnormal vwa1pkm101/pkm101 (TU) standard conditions Figure 6 with image from Niu et al., 2023
ceratobranchial cartilage decreased amount, abnormal vwa1pkm101/pkm101 (TU) control Figure 2 with image from Niu et al., 2023
whole organism vwa1 expression decreased amount, abnormal vwa1pkm101/pkm101 (TU) standard conditions Figure 2 with image from Niu et al., 2023
pericardium edematous, abnormal vwa1pkm101/pkm101 (TU) control Figure 2 with image from Niu et al., 2023
pharyngeal arch fgfr2 expression decreased distribution, abnormal vwa1pkm101/pkm101 (TU) standard conditions Figure 6 with image from Niu et al., 2023
swim bladder uninflated, abnormal vwa1pkm101/pkm101 (TU) control Figure 2 with image from Niu et al., 2023
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal vwa1pkm101/pkm101 (TU) control Figure 2 with image from Niu et al., 2023
Meckel's cartilage hypoplastic, abnormal vwa1pkm101/pkm101 (TU) control Figure 2 with image from Niu et al., 2023
pharyngeal arch col2a1a expression decreased distribution, abnormal vwa1pkm101/pkm101 (TU) standard conditions Figure 4 with image from Niu et al., 2023
ventral mandibular arch dysplastic, abnormal vwa1pkm101/pkm101 (TU) control Figure 2 with image from Niu et al., 2023
whole organism vwa1 expression decreased amount, abnormal TU + CRISPR4-vwa1 control Figure 2 with image from Niu et al., 2023
ventral mandibular arch dysplastic, abnormal TU + CRISPR4-vwa1 control Figure 2 with image from Niu et al., 2023
palatoquadrate cartilage hypoplastic, abnormal TU + CRISPR4-vwa1 control Figure 2 with image from Niu et al., 2023
ceratobranchial cartilage hypoplastic, abnormal TU + CRISPR4-vwa1 control Figure 2 with image from Niu et al., 2023
ceratobranchial cartilage decreased amount, abnormal TU + CRISPR4-vwa1 control Figure 2 with image from Niu et al., 2023
pericardium edematous, abnormal TU + CRISPR4-vwa1 control Figure 2 with image from Niu et al., 2023
swim bladder uninflated, abnormal TU + CRISPR4-vwa1 control Figure 2 with image from Niu et al., 2023
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal TU + CRISPR4-vwa1 control Figure 2 with image from Niu et al., 2023
Meckel's cartilage hypoplastic, abnormal TU + CRISPR4-vwa1 control Figure 2 with image from Niu et al., 2023
cranial cartilage chondrocyte hypoplastic, abnormal vwa1pkm101/pkm101; ba2Tg (TU) standard conditions Figure 3 with image from Niu et al., 2023
pharyngeal arch Ab47-h3 labeling decreased distribution, abnormal vwa1pkm101/pkm101; ba2Tg (TU) standard conditions Figure 5 with image from Niu et al., 2023
cranial cartilage chondrocyte disorganized, abnormal vwa1pkm101/pkm101; ba2Tg (TU) standard conditions Figure 3 with image from Niu et al., 2023
pharyngeal arch cell population proliferation decreased process quality, abnormal vwa1pkm101/pkm101; ba2Tg (TU) standard conditions Figure 5 with image from Niu et al., 2023
cranial neural crest cell apoptotic process increased process quality, abnormal vwa1pkm101/pkm101; ba2Tg (TU) standard conditions Figure 5 with image from Niu et al., 2023
cranial cartilage joint morphology, abnormal WT + CRISPR1-vwa1 + CRISPR2-vwa1 + CRISPR3-vwa1 + CRISPR4-vwa1 + MO1-upf3a control FIGURE 4 with image from Wang et al., 2020
pharyngeal arch 3-7 absent, abnormal WT + CRISPR1-vwa1 + CRISPR2-vwa1 + CRISPR3-vwa1 + CRISPR4-vwa1 + MO1-upf3a control FIGURE 4 with image from Wang et al., 2020
pharyngeal arch 1 hypoplastic, abnormal WT + CRISPR1-vwa1 + CRISPR2-vwa1 + CRISPR3-vwa1 + CRISPR4-vwa1 + MO1-upf3a control FIGURE 4 with image from Wang et al., 2020
pharyngeal arch 2 hypoplastic, abnormal WT + CRISPR1-vwa1 + CRISPR2-vwa1 + CRISPR3-vwa1 + CRISPR4-vwa1 + MO1-upf3a control FIGURE 4 with image from Wang et al., 2020
Citations