CRISPR

CRISPR3-gata5

ID
ZDB-CRISPR-210322-1
Name
CRISPR3-gata5
Previous Names
None
Target
Sequence
5' - GGGCGCGAGTGTGTGAACTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
wcm10 gata5
wcm11 gata5
wcm8 gata5
wcm9 gata5
Expression
Gene expression in Wild Types + CRISPR3-gata5
No data available
Phenotype
Phenotype resulting from CRISPR3-gata5
No data available
Phenotype of all Fish created by or utilizing CRISPR3-gata5
Citations