CRISPR

CRISPR1-mfap4

ID
ZDB-CRISPR-210309-1
Name
CRISPR1-mfap4
Previous Names
None
Targets
Sequence
5' - GTGACTGTACATCCATGCCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
imb5 mfap4.2
Expression
Gene expression in Wild Types + CRISPR1-mfap4
No data available
Phenotype
Phenotype resulting from CRISPR1-mfap4
No data available
Phenotype of all Fish created by or utilizing CRISPR1-mfap4
Phenotype Fish Conditions Figures
erythroid progenitor cell gata1a expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
granulocyte monocyte progenitor cell spi1b expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
common myeloid progenitor spi1b expression increased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
macrophage lcp1 expression increased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
hematopoietic multipotent progenitor cell gata2a expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
hematopoietic multipotent progenitor cell runx1 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
macrophage mfap4.2 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 2 with image from Ong et al., 2020
neutrophil mpx expression increased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
granulocyte cpa5 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
whole organism mfap4.2 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 2 with image from Ong et al., 2020
lymphoid progenitor cell ikzf1 expression decreased amount, abnormal mfap4.2imb5/imb5 standard conditions Figure 5 with image from Ong et al., 2020
macrophage EGFP expression decreased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg amputation: caudal fin Figure 3 with image from Ong et al., 2020
regenerating fin macrophage EGFP expression decreased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg amputation: caudal fin Figure 3 with image from Ong et al., 2020
macrophage EGFP expression decreased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg standard conditions Figure 3 with image from Ong et al., 2020
regenerating fin neutrophil migration increased rate of occurrence, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg amputation: caudal fin Figure 4 with image from Ong et al., 2020
regenerating fin neutrophil EGFP expression increased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg amputation: caudal fin Figure 4 with image from Ong et al., 2020
caudal fin neutrophil EGFP expression increased amount, abnormal mfap4.2imb5/imb5; gl22Tg/gl22Tg standard conditions Figure 4 with image from Ong et al., 2020
Citations