CRISPR

CRISPR2-pgk1

ID

ZDB-CRISPR-210223-2

Name

CRISPR2-pgk1

Previous Names

None

Target

pgk1 (1)

Sequence

5' - AAGGAAAGCGGGTGATCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
x55	pgk1

Expression

Gene expression in Wild Types + CRISPR2-pgk1

No data available

Phenotype

Phenotype resulting from CRISPR2-pgk1

No data available

Phenotype of all Fish created by or utilizing CRISPR2-pgk1

Phenotype	Fish	Conditions	Figures
otic vesicle etv5b expression decreased amount, abnormal	pgk1^x55/x55	control	Figure 4 , Figure 6 from Kantarci et al., 2020
otic vesicle pax5 expression decreased amount, abnormal	pgk1^x55/x55	control	Figure 7 from Kantarci et al., 2020
otic vesicle neurog1 expression amount, ameliorated	pgk1^x55/x55	chemical treatment by environment: lactate	Figure 6 from Kantarci et al., 2020
otic vesicle etv5b expression amount, ameliorated	pgk1^x55/x55	chemical treatment by environment: lactate	Figure 6 from Kantarci et al., 2020
otic vesicle etv5b expression decreased amount, abnormal	pgk1^x55/x55	chemical treatment by environment: ATP	Figure 6 from Kantarci et al., 2020
otic vesicle neurog1 expression decreased amount, abnormal	pgk1^x55/x55	chemical treatment by environment: ATP	Figure 6 from Kantarci et al., 2020
otic vesicle neurod1 expression decreased amount, abnormal	pgk1^x55/x55	control	Figure 4 from Kantarci et al., 2020
otic vesicle neurog1 expression decreased amount, abnormal	pgk1^x55/x55	control	Figure 4 , Figure 6 from Kantarci et al., 2020
statoacoustic (VIII) ganglion posterior region has fewer parts of type neuron, abnormal	pgk1^x55/x55; zc7Tg	control	Figure 4 from Kantarci et al., 2020
statoacoustic (VIII) ganglion anterior region has fewer parts of type neuron, abnormal	pgk1^x55/x55; zc7Tg	control	Figure 4 from Kantarci et al., 2020
hair cell posterior macula decreased amount, abnormal	pgk1^x55/x55; zc7Tg	control	Figure 4 from Kantarci et al., 2020
hair cell anterior macula decreased amount, abnormal	pgk1^x55/x55; zc7Tg	control	Figure 4 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal	pgk1^x55/x55; zc7Tg	control	Figure 4 , Figure 5 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal	pgk1^x55/x55; zc7Tg	heat shock	Figure 4 - figure supplement 4 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has normal numbers of parts of type neuron, ameliorated	pgk1^x55/x55; zc7Tg	chemical treatment by environment: lactate	Figure 5 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal	pgk1^x55/x55; zc7Tg	chemical treatment by environment: 2-deoxy-D-glucose	Figure 5 from Kantarci et al., 2020
otic vesicle pax5 expression spatial pattern, abnormal	pgk1^x55/x55; x17Tg	heat shock	Figure 7 from Kantarci et al., 2020
otic vesicle pax5 expression increased distribution, abnormal	pgk1^x55/x55; x17Tg	heat shock	Figure 7 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal	pgk1^x55/x55; x66Tg; zc7Tg	heat shock	Figure 4 - figure supplement 4 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal	pgk1^x55/x55; zc7Tg + MO1-plg + MO4-tp53	control	Figure 4 - figure supplement 6 from Kantarci et al., 2020
statoacoustic (VIII) ganglion has fewer parts of type neuron, abnormal	pgk1^x55/x55; zc7Tg + MO2-plg + MO4-tp53	control	Figure 4 - figure supplement 6 from Kantarci et al., 2020

Citations