CRISPR

CRISPR1-dkc1

ID

ZDB-CRISPR-210216-1

Name

CRISPR1-dkc1

Previous Names

None

Target

dkc1 (1)

Sequence

5' - AGATGGTGCGCACTCGCAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
elu1	dkc1
elu2	dkc1

Expression

Gene expression in Wild Types + CRISPR1-dkc1

No data available

Phenotype

Phenotype resulting from CRISPR1-dkc1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-dkc1

Phenotype	Fish	Conditions	Figures
blood gata1a expression decreased amount, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
semicircular canal deformed, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
mandibular arch skeleton absent, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. S8 from Balogh et al., 2020
blood rag1 expression decreased amount, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
whole organism decreased life span, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. text only from Balogh et al., 2020
eye decreased size, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 , Fig. S8 from Balogh et al., 2020
intestine fabp2 expression decreased amount, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
retina ccnd1 expression spatial pattern, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
pancreas prss1 expression decreased amount, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
lens opaque, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
rRNA pseudouridine synthesis process quality, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 5 from Balogh et al., 2020
maturation of SSU-rRNA process quality, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 5 from Balogh et al., 2020
pronephros hypoplastic, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
optic tectum morphology, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
gut undifferentiated, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
whole organism dead, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. text only from Balogh et al., 2020
retina ccnd1 expression increased distribution, abnormal	dkc1^elu1/elu1 (TU)	standard conditions	Fig. 4 from Balogh et al., 2020
developmental growth delayed, abnormal	dkc1^elu2/elu2 (TU)	standard conditions	Fig. 5 from Balogh et al., 2020
whole organism decreased weight, abnormal	dkc1^elu2/elu2 (TU)	standard conditions	Fig. 5 from Balogh et al., 2020
optic tectum morphology, abnormal	tp53^zdf1/zdf1; dkc1^elu1/elu1	standard conditions	Fig. 5 from Balogh et al., 2020
gut undifferentiated, abnormal	tp53^zdf1/zdf1; dkc1^elu1/elu1	standard conditions	Fig. 5 from Balogh et al., 2020
pronephros hypoplastic, abnormal	tp53^zdf1/zdf1; dkc1^elu1/elu1	standard conditions	Fig. 5 from Balogh et al., 2020
eye decreased size, abnormal	tp53^zdf1/zdf1; dkc1^elu1/elu1	standard conditions	Fig. 5 from Balogh et al., 2020
lens opaque, abnormal	tp53^zdf1/zdf1; dkc1^elu1/elu1	standard conditions	Fig. 5 from Balogh et al., 2020

Citations