CRISPR

CRISPR1-adamts13

ID

ZDB-CRISPR-210108-1

Name

CRISPR1-adamts13

Previous Names

None

Target

adamts13 (1)

Sequence

5' - GCCTCCCTTTGAGATAGTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ku4	adamts13
utn10	adamts13

Expression

Gene expression in Wild Types + CRISPR1-adamts13

No data available

Phenotype

Phenotype resulting from CRISPR1-adamts13

No data available

Phenotype of all Fish created by or utilizing CRISPR1-adamts13

Phenotype	Fish	Conditions	Figures
blood plasma adamts13 expression absent, abnormal	adamts13^ku4/ku4	standard conditions	Fig. 1 from Zheng et al., 2019
thrombocyte decreased amount, abnormal	adamts13^ku4/ku4	standard conditions	Fig. 7 from Zheng et al., 2019
whole organism adamts13 expression absent, abnormal	adamts13^ku4/ku4	standard conditions	Fig. 1 from Zheng et al., 2019
thrombocyte decreased amount, exacerbated	adamts13^ku4/ku4	chemical treatment by injection: Histone-L-lysine	Fig. 4 from Zheng et al., 2019
whole organism decreased life span, exacerbated	adamts13^ku4/ku4	chemical treatment by injection: Histone-L-lysine	Fig. 5 from Zheng et al., 2019
blood plasma proteolysis decreased occurrence, abnormal	adamts13^ku4/ku4	standard conditions	Fig. 1 from Zheng et al., 2019
thrombocyte activation increased occurrence, exacerbated	adamts13^ku4/ku4	chemical treatment by injection: Histone-L-lysine	Fig. 5 from Zheng et al., 2019
caudal vein vascular endothelium damaged, abnormal	adamts13^ku4/ku4; sd2Tg; y1Tg	chemical treatment: iron trichloride	Fig. 2 from Zheng et al., 2019
platelet aggregation increased efficacy, abnormal	adamts13^ku4/ku4; sd2Tg; y1Tg	chemical treatment: iron trichloride	Fig. 2 from Zheng et al., 2019
caudal vein blood coagulation delayed, abnormal	adamts13^ku4/ku4; vwf^ku5/ku5	chemical treatment: iron trichloride	Fig. 6 from Zheng et al., 2019
thrombocyte normal amount, ameliorated	adamts13^ku4/ku4; vwf^ku5/ku5	standard conditions	Fig. 7 from Zheng et al., 2019
whole organism vegfaa expression decreased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg	standard conditions	Fig. 4 from Sartori et al., 2025
myeloid cell increased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg	standard conditions	Fig. 6 from Sartori et al., 2025
intersegmental vessel decreased length, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg	standard conditions	Fig. 4 from Sartori et al., 2025
intersegmental vessel morphology, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg	standard conditions	Fig. 4 from Sartori et al., 2025
erythroid lineage cell decreased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg	standard conditions	Fig. 6 from Sartori et al., 2025
whole organism tnfa expression decreased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 5 from Sartori et al., 2025
whole organism il6 expression decreased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 5 from Sartori et al., 2025
nucleate erythrocyte decreased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 1 from Sartori et al., 2025
nucleate erythrocyte fragmented, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 1 from Sartori et al., 2025
whole organism mpeg1.1 expression decreased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 5 , Fig. 6 from Sartori et al., 2025
whole organism mpx expression decreased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 6 from Sartori et al., 2025
blood coagulation increased rate of occurrence, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 3 from Sartori et al., 2025
whole organism marco expression decreased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 6 from Sartori et al., 2025
whole organism gata1a expression decreased amount, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 6 from Sartori et al., 2025
nucleate erythrocyte morphology, abnormal	mitfa^w2/w2; adamts13^utn10/utn10; mpv17^a9/a9; s843Tg; sd2Tg	standard conditions	Fig. 1 from Sartori et al., 2025

Citations