CRISPR

CRISPR1-pheta2

ID

ZDB-CRISPR-210105-9

Name

CRISPR1-pheta2

Previous Names

CRISPR1-zgc:153733

Target

pheta2 (1)

Sequence

5' - GGTCTCTGACTATCATGGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genome Build: GRCz11Chromosome: 3

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
vt3	pheta2

Expression

Gene expression in Wild Types + CRISPR1-pheta2

No data available

Phenotype

Phenotype resulting from CRISPR1-pheta2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-pheta2

Phenotype	Fish	Conditions	Figures
cranium decreased length, abnormal	pheta2^vt3/vt3	standard conditions	Fig. 4. from Ates et al., 2020
Meckel's cartilage decreased area, abnormal	pheta2^vt3/vt3	standard conditions	Fig. 4. from Ates et al., 2020
ceratohyal bone ossification decreased process quality, abnormal	pheta2^vt3/vt3	standard conditions	Fig. 4. from Ates et al., 2020
pinocytosis decreased efficacy, abnormal	pheta2^vt3/vt3	standard conditions	Fig. 3. from Ates et al., 2020
ceratohyal cartilage ab1-col2a labeling increased amount, abnormal	pheta2^vt3/vt3	standard conditions	Fig. 5. from Ates et al., 2020
ceratohyal cartilage decreased length, abnormal	pheta2^vt3/vt3	standard conditions	Fig. 4. from Ates et al., 2020
Meckel's cartilage ab1-col2a labeling increased amount, abnormal	pheta2^vt3/vt3	standard conditions	Fig. 5. from Ates et al., 2020
ventral mandibular arch decreased width and length, abnormal	pheta2^vt3/vt3	standard conditions	Fig. 4. from Ates et al., 2020
chondrocyte axis elongation disrupted, abnormal	pheta2^vt3/vt3	standard conditions	Fig. 5. from Ates et al., 2020
chondrocyte axis elongation disrupted, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 5. from Ates et al., 2020
cranium decreased length, ameliorated	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
ceratohyal cartilage decreased length, ameliorated	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
ceratohyal cartilage ab1-col2a labeling increased amount, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 5. from Ates et al., 2020
ventral mandibular arch decreased width and length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. from Ates et al., 2020
Meckel's cartilage decreased area, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. , Fig. 6. from Ates et al., 2020
cranium decreased length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. , Fig. 6. from Ates et al., 2020
ventral mandibular arch increased length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
pronephros cilium decreased length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 3. from Ates et al., 2020
ventral mandibular arch decreased width, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	control	Fig. 6. from Ates et al., 2020
Meckel's cartilage ab1-col2a labeling increased amount, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 5. from Ates et al., 2020
Meckel's cartilage decreased area, ameliorated	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
pronephros cilium decreased amount, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 3. from Ates et al., 2020
ceratohyal bone ossification decreased process quality, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. from Ates et al., 2020
ceratohyal cartilage decreased width, ameliorated	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020
ceratohyal cartilage decreased width, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	control	Fig. 6. from Ates et al., 2020
ceratohyal cartilage decreased length, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	standard conditions	Fig. 4. , Fig. 6. from Ates et al., 2020
ventral mandibular arch decreased width, abnormal	pheta1^vt2/vt2; pheta2^vt3/vt3	chemical treatment: EC 3.4.22.38 (cathepsin K) inhibitor	Fig. 6. from Ates et al., 2020

Citations

Include unpublished citations

Ates, K.M., Wang, T., Moreland, T., Veeranan-Karmegam, R., Ma, M., Jeter, C., Anand, P., Wenzel, W., Kim, H.G., Wolfe, L.A., Stephen, J.A., Adams, D.R., Markello, T., Tifft, C.J., Settlage, R., Gahl, W.A., Gonsalvez, G.B., Malicdan, M.C., Flanagan-Steet, H., Pan, Y.A. (2020) Deficiency in the endocytic adaptor proteins PHETA1/2 impair renal and craniofacial development. Disease models & mechanisms. 13(5):

1 - 1 of 1

Show